v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apis mellifera (honey bee) ame-let-7-5p URS00004B50F3_7460

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ame-let-7: Ame-let-7 is a microRNA (miRNA) that is differentially expressed in honeybee larvae, with queen larvae showing twice the expression level compared to worker bee larvae [PMC6942390]. This miRNA is a key player in the honeybee's immune signaling pathways, including IMD, JNK, and Toll pathways, and is involved in the regulation of antimicrobial peptide production [PMC8532292]. Ame-let-7, along with ame-miR-100 and ame-miR-125, is highly expressed in wing discs and located on the LG8 linkage group of the honeybee genome [PMC8532292]. It also appears on the same scaffold as ame-mir-100 within a cluster of miRNAs that are conserved across different animal species [PMC2394756]. Notably, ame-let-7 has been identified in royal jelly (RJ), along with other miRNAs common to animal bodies or products like milk [PMC3424160]. Furthermore, research has shown that expression levels of ame-miR-9a and ame-let-7 are higher in male bees compared to females, suggesting a significant role for these miRNAs in male bee development [PMC6835379].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUAGUAGGUUGUAUAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Bactrocera dorsalis bdo-let-7
  2. Bombyx mori bmo-let-7-5p
  3. Caenorhabditis briggsae let-7 RNA
  4. Caenorhabditis elegans let-7 RNA
  5. Capitella teleta cte-let-7
  6. Cochliomyia hominivorax (primary screw-worm) mature cho-let-7-5p
  7. Cochliomyia macellaria (secondary screw-worm) mature cma-let-7-5p
  8. Dinoponera quadriceps dqu-let-7-5p
  9. Drosophila ananassae dan-let-7
  10. Drosophila erecta der-let-7
  11. Drosophila grimshawi dgr-let-7
  12. Drosophila melanogaster dme-let-7-5p
  13. Drosophila mojavensis dmo-let-7
  14. Drosophila persimilis dpe-let-7
  15. Drosophila pseudoobscura dps-let-7
  16. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294455_df_nrg
  17. Drosophila sechellia dse-let-7
  18. Drosophila simulans dsi-let-7
  19. Drosophila virilis dvi-let-7
  20. Drosophila willistoni dwi-let-7
  21. Drosophila yakuba dya-let-7
  22. Gorilla gorilla gorilla ggo-let-7a (MIRLET7A)
  23. Gorilla gorilla ggo-let-7a
  24. Ixodes scapularis (black-legged tick) isc-let-7
  25. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72408
  26. Nasonia giraulti ngi-let-7
  27. Nasonia vitripennis nvi-let-7
  28. Oryzias latipes (Japanese medaka) ola-let-7a-5p
  29. Ovis aries (sheep) microRNA let-7a
  30. Platynereis dumerilii (Dumeril's clam worm) let-7
  31. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62870
  32. Candidatus Harpocratesius repetitus RNA (5'-R(P*UP*GP*AP*GP*GP*U*(MG))-3') from Candidatus Harpocratesius repetitus (PDB 8R3Z, chain B)
  33. synthetic construct RNA (5'-R(P*UP*GP*AP*GP*GP*UP*AP*GP*UP*AP*GP*GP*UP*UP*GP*UP*AP*UP*A)-3') from synthetic construct (PDB 8U72, chain X)
  34. Sarcophilus harrisii sha-let-7a
  35. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-5094987
 Relationships

Molecular Relationships

 Publications