Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-224-5p URS00004A785A_9925

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

chi-mir-224: Chi-mir-224 is a microRNA that was found to be significantly downregulated in goats in response to weaning stress, indicating a suppression of cell proliferation activity in post-weaning goats [PMC6687162]. In addition to chi-mir-224, other miRNAs such as chi-miR-99b-3p, chi-miR-143-5p, and chi-miR-10b-5p were also downregulated in response to weaning stress [PMC6687162]. These miRNAs are related to cell proliferation and muscle development [PMC6687162]. Furthermore, the expression profiles of these downregulated miRNAs were found to be highly expressed in muscle tissues of 7-month old Chongming white goats [PMC6687162]. These findings suggest that these miRNAs play important roles in goat muscle development [PMC6687162]. Additionally, other downregulated miRNAs such as chi-miR-199a-5p are involved in cell proliferation, apoptosis, and differentiation [PMC6687162]. The downregulation of muscle development-related miRNAs (chi-miR-206 and chi-miR-133a/b) and potential muscle development-associated miRNAs (chi-miR-99b3p, chi-mir224, chi-miR1435p, and chi-miR10b5p) provides important information on weaning-induced growth inhibition in domestic animals [PMC6687162]. The downregulation of cell proliferation-associated miRNAs (chi-miR99b3p, chi-mir224, chi-MIR1435P) also suggests a repression of post-weaning cell proliferation in goats [PMC6687162].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAGUCACUAGUGGUUCCGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Canis lupus familiaris (dog) cfa-miR-224
  2. Cervus elaphus (red deer) cel-miR-224
  3. Nomascus leucogenys nle-miR-224
  4. Rattus norvegicus rno-miR-224-5p
Publications