Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6) secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6) URS00004A686E_559292

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (IntAct, GtRNAdb, ENA). Described in 11 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6) sequence is a product of tRNA-Trp-CCA-1-5, tRNA-Trp-CCA-1-6, tRNA-Trp-CCA-1-3, tRNA-Trp-CCA-1-4, tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2 genes.

Interactions 1

According to IntAct, Saccharomyces cerevisiae S288C tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6) interacts with:

Interaction id Participant Synonyms
EBI-11704041 Q12211 D6W3F8 EBI-14272 PUS1 Q12211 YPL212C pus1_yeast tRNA pseudouridylate synthase 1 tRNA-uridine isomerase 1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GAAGCGGUGGCUCAAUGGUAGAGCUUUCGACUCCAAAUCGAAGGGUUGCAGGUUCAAUUCCUGUCCGUUUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 125 other species

    1. Saccharomyces arboricola H-6 tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1)
    2. Saccharomyces boulardii (nom. inval.) tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    3. Saccharomyces cerevisiae AWRI796 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    4. Saccharomyces cerevisiae tRNA-Trp(TGG)
    5. Saccharomyces cerevisiae CBS 7960 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    6. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    7. Saccharomyces cerevisiae CLIB215 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    8. Saccharomyces cerevisiae CLIB324 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    9. Saccharomyces cerevisiae CLIB382 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
    10. Saccharomyces cerevisiae EC1118 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    11. Saccharomyces cerevisiae EC9-8 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    12. Saccharomyces cerevisiae FL100 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 7)
    13. Saccharomyces cerevisiae FostersB tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    14. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    15. Saccharomyces cerevisiae Lalvin QA23 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    16. Saccharomyces cerevisiae P283 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    17. Saccharomyces cerevisiae P301 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 5)
    18. Saccharomyces cerevisiae PE-2 tRNA-Trp
    19. Saccharomyces cerevisiae R008 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    20. Saccharomyces cerevisiae R103 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    21. Saccharomyces cerevisiae RM11-1a tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    22. Saccharomyces cerevisiae Sigma1278b tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    23. Saccharomyces cerevisiae T73 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 4)
    24. Saccharomyces cerevisiae T7 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    25. Saccharomyces cerevisiae UC5 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    26. Saccharomyces cerevisiae UFMG A-905 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    27. Saccharomyces cerevisiae Vin13 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    28. Saccharomyces cerevisiae VL3 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 5)
    29. Saccharomyces cerevisiae W303 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    30. Saccharomyces cerevisiae Y10 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 5)
    31. Saccharomyces cerevisiae YJM1078 tRNA-Trp
    32. Saccharomyces cerevisiae YJM1083 tRNA-Trp
    33. Saccharomyces cerevisiae YJM1129 tRNA-Trp
    34. Saccharomyces cerevisiae YJM1133 tRNA-Trp
    35. Saccharomyces cerevisiae YJM1190 tRNA-Trp
    36. Saccharomyces cerevisiae YJM1199 tRNA-Trp
    37. Saccharomyces cerevisiae YJM1202 tRNA-Trp
    38. Saccharomyces cerevisiae YJM1208 tRNA-Trp
    39. Saccharomyces cerevisiae YJM1242 tRNA-Trp
    40. Saccharomyces cerevisiae YJM1244 tRNA-Trp
    41. Saccharomyces cerevisiae YJM1248 tRNA-Trp
    42. Saccharomyces cerevisiae YJM1250 tRNA-Trp
    43. Saccharomyces cerevisiae YJM1252 tRNA-Trp
    44. Saccharomyces cerevisiae YJM1273 tRNA-Trp
    45. Saccharomyces cerevisiae YJM1304 tRNA-Trp
    46. Saccharomyces cerevisiae YJM1307 tRNA-Trp
    47. Saccharomyces cerevisiae YJM1311 tRNA-Trp
    48. Saccharomyces cerevisiae YJM1326 tRNA-Trp
    49. Saccharomyces cerevisiae YJM1332 tRNA-Trp
    50. Saccharomyces cerevisiae YJM1336 tRNA-Trp
    51. Saccharomyces cerevisiae YJM1338 tRNA-Trp
    52. Saccharomyces cerevisiae YJM1341 tRNA-Trp
    53. Saccharomyces cerevisiae YJM1342 tRNA-Trp
    54. Saccharomyces cerevisiae YJM1355 tRNA-Trp
    55. Saccharomyces cerevisiae YJM1356 tRNA-Trp
    56. Saccharomyces cerevisiae YJM1381 tRNA-Trp
    57. Saccharomyces cerevisiae YJM1383 tRNA-Trp
    58. Saccharomyces cerevisiae YJM1385 tRNA-Trp
    59. Saccharomyces cerevisiae YJM1386 tRNA-Trp
    60. Saccharomyces cerevisiae YJM1387 tRNA-Trp
    61. Saccharomyces cerevisiae YJM1388 tRNA-Trp
    62. Saccharomyces cerevisiae YJM1389 tRNA-Trp
    63. Saccharomyces cerevisiae YJM1399 tRNA-Trp
    64. Saccharomyces cerevisiae YJM1400 tRNA-Trp
    65. Saccharomyces cerevisiae YJM1401 tRNA-Trp
    66. Saccharomyces cerevisiae YJM1402 tRNA-Trp
    67. Saccharomyces cerevisiae YJM1415 tRNA-Trp
    68. Saccharomyces cerevisiae YJM1417 tRNA-Trp
    69. Saccharomyces cerevisiae YJM1418 tRNA-Trp
    70. Saccharomyces cerevisiae YJM1419 tRNA-Trp
    71. Saccharomyces cerevisiae YJM1433 tRNA-Trp
    72. Saccharomyces cerevisiae YJM1434 tRNA-Trp
    73. Saccharomyces cerevisiae YJM1439 tRNA-Trp
    74. Saccharomyces cerevisiae YJM1443 tRNA-Trp
    75. Saccharomyces cerevisiae YJM1444 tRNA-Trp
    76. Saccharomyces cerevisiae YJM1447 tRNA-Trp
    77. Saccharomyces cerevisiae YJM1450 tRNA-Trp
    78. Saccharomyces cerevisiae YJM1460 tRNA-Trp
    79. Saccharomyces cerevisiae YJM1463 tRNA-Trp
    80. Saccharomyces cerevisiae YJM1477 tRNA-Trp
    81. Saccharomyces cerevisiae YJM1478 tRNA-Trp
    82. Saccharomyces cerevisiae YJM1479 tRNA-Trp
    83. Saccharomyces cerevisiae YJM1526 tRNA-Trp
    84. Saccharomyces cerevisiae YJM1527 tRNA-Trp
    85. Saccharomyces cerevisiae YJM1549 tRNA-Trp
    86. Saccharomyces cerevisiae YJM1573 tRNA-Trp
    87. Saccharomyces cerevisiae YJM1574 tRNA-Trp
    88. Saccharomyces cerevisiae YJM1592 tRNA-Trp
    89. Saccharomyces cerevisiae YJM1615 tRNA-Trp
    90. Saccharomyces cerevisiae YJM189 tRNA-Trp
    91. Saccharomyces cerevisiae YJM193 tRNA-Trp
    92. Saccharomyces cerevisiae YJM195 tRNA-Trp
    93. Saccharomyces cerevisiae YJM244 tRNA-Trp
    94. Saccharomyces cerevisiae YJM248 tRNA-Trp
    95. Saccharomyces cerevisiae YJM269 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 5)
    96. Saccharomyces cerevisiae YJM270 tRNA-Trp
    97. Saccharomyces cerevisiae YJM271 tRNA-Trp
    98. Saccharomyces cerevisiae YJM320 tRNA-Trp
    99. Saccharomyces cerevisiae YJM326 tRNA-Trp
    100. Saccharomyces cerevisiae YJM428 tRNA-Trp
    101. Saccharomyces cerevisiae YJM450 tRNA-Trp
    102. Saccharomyces cerevisiae YJM451 tRNA-Trp
    103. Saccharomyces cerevisiae YJM453 tRNA-Trp
    104. Saccharomyces cerevisiae YJM456 tRNA-Trp
    105. Saccharomyces cerevisiae YJM470 tRNA-Trp
    106. Saccharomyces cerevisiae YJM541 tRNA-Trp
    107. Saccharomyces cerevisiae YJM554 tRNA-Trp
    108. Saccharomyces cerevisiae YJM555 tRNA-Trp
    109. Saccharomyces cerevisiae YJM627 tRNA-Trp
    110. Saccharomyces cerevisiae YJM681 tRNA-Trp
    111. Saccharomyces cerevisiae YJM682 tRNA-Trp
    112. Saccharomyces cerevisiae YJM683 tRNA-Trp
    113. Saccharomyces cerevisiae YJM689 tRNA-Trp
    114. Saccharomyces cerevisiae YJM693 tRNA-Trp
    115. Saccharomyces cerevisiae YJM969 tRNA-Trp
    116. Saccharomyces cerevisiae YJM972 tRNA-Trp
    117. Saccharomyces cerevisiae YJM975 tRNA-Trp
    118. Saccharomyces cerevisiae YJM978 tRNA-Trp
    119. Saccharomyces cerevisiae YJM981 tRNA-Trp
    120. Saccharomyces cerevisiae YJM984 tRNA-Trp
    121. Saccharomyces cerevisiae YJM987 tRNA-Trp
    122. Saccharomyces cerevisiae YJM990 tRNA-Trp
    123. Saccharomyces cerevisiae YJM993 tRNA-Trp
    124. Saccharomyces cerevisiae YJM996 tRNA-Trp
    125. Saccharomyces cerevisiae YJSH1 tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 6)
    126. Saccharomyces kudriavzevii IFO 1802 tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
    2D structure New