v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000023392.2) secondary structure diagram

Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000023392.2) URS00004A6370_1868482

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCCUCAGAUCAGAAGGUGAUUGUGGCUUUGGGUGGAUAUUAAUCAGCCACAGCACUGCCUGGUCAGAAAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Ailuropoda melanoleuca microRNA mir-383
  2. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000002513.1, ENSANAG00000002537.1)
  3. Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-383
  4. Camelus ferus microRNA mir-383
  5. Canis lupus familiaris (dog) microRNA mir-383
  6. Capra hircus (Goat) microRNA mir-383 (ENSCHIG00000009498.1)
  7. Cebus imitator microRNA 383 (ENSCCAG00000011972.1)
  8. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000017120.1)
  9. Chlorocebus sabaeus microRNA mir-383
  10. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000016368.1)
  11. Echinops telfairi miRNA (ENSETEG00000021632.1)
  12. Equus caballus microRNA eca-mir-383 precursor
  13. Gorilla gorilla gorilla microRNA 383 (ENSGGOG00000029461.2)
  14. Gorilla gorilla microRNA mir-383
  15. Homo sapiens microRNA hsa-mir-383 precursor
  16. Loxodonta africana microRNA 383 (ENSLAFG00000023910.2)
  17. Macaca mulatta microRNA mml-mir-383 precursor
  18. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000003955.1)
  19. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000012461.1)
  20. Mustela putorius furo microRNA mir-383
  21. Pan paniscus microRNA 383 (ENSPPAG00000005797.1)
  22. Panthera pardus microRNA 383 (ENSPPRG00000014018.1)
  23. Panthera tigris altaica microRNA 383 (ENSPTIG00000002586.1)
  24. Pan troglodytes (chimpanzee) ptr-mir-383 (ENSPTRG00000027823.2)
  25. Papio anubis (Olive baboon) microRNA mir-383
  26. Pongo abelii microRNA mir-383
  27. Pongo pygmaeus microRNA ppy-mir-383 precursor
  28. Procavia capensis (cape rock hyrax) miRNA (ENSPCAG00000019696.1)
  29. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000000472.1)
  30. Pteropus alecto microRNA mir-383
  31. Rhinopithecus bieti miRNA (ENSRBIG00000000689.1)
  32. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000037259.1)
  33. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000009463.1)
  34. Tupaia belangeri (northern tree shrew) microRNA 383 (ENSTBEG00000018033.1)
  35. Tupaia chinensis microRNA mir-383
  36. Tursiops truncatus microRNA 383 (ENSTTRG00000022798.1)
 2D structure