Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR393a URS00004A46D8_4530

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAAAGGGAUCGCAUUGAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Ananas comosus (pineapple) microRNA 393b
  2. Arabidopsis thaliana (thale cress) Ath_wt_07292
  3. Brachypodium distachyon bdi-miR393b-5p
  4. Brassica napus bna-miR393
  5. Citrus sinensis csi-miR393c-5p
  6. Cucumis melo (muskmelon) cme-miR393b
  7. Cynara cardunculus var. scolymus cca-miR393b
  8. Fragaria vesca subsp. vesca fve-miR393a
  9. Glycine max gma-miR393a
  10. Helianthus annuus (common sunflower) osa-miR393a
  11. Linum usitatissimum lus-miR393d
  12. Manihot esculenta mes-miR393a
  13. Medicago truncatula (barrel medic) mtr-miR393a
  14. Oryza sativa Japonica Group microRNA osa-miR393a
  15. Populus tomentosa Pto-miR393c
  16. Populus trichocarpa (black cottonwood) ptc-miR393b-5p
  17. Prunus persica ppe-miR393b
  18. Ricinus communis (castor bean) rco-miR393
  19. Sorghum bicolor sbi-miR393a
  20. Theobroma cacao tcc-miR393b
  21. Vitis vinifera vvi-miR393a
  22. Vriesea carinata vca-miR393-5p
Publications