Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Thermus sp. 2.9 tRNA-Val secondary structure diagram

Thermus sp. 2.9 tRNA-Val URS00004A2E91_1577051

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCGGCUAGCUCAGCGGAAGAGCGCUCGCCUCACACGCGAGAGGUCGUAGGUUCAAGUCCUACGCCGCCCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Acidobacteriota bacterium tRNA-Val
  2. Deinococcota bacterium tRNA-Val
  3. Thermus aquaticus tRNA-Val
  4. Thermus aquaticus Y51MC23 tRNA-Val
  5. Thermus arciformis tRNA_Val_CAC
  6. Thermus brockianus tRNA-Val
  7. Thermus caldifontis tRNA-Val
  8. Thermus caliditerrae (hot springs metagenome) tRNA-Val
  9. Thermus composti tRNA-Val
  10. Thermus hydrothermalis tRNA-Val
  11. Thermus islandicus (sediment metagenome) tRNA-Val
  12. Thermus kawarayensis tRNA-Val
  13. Thermus oshimai JL-2 tRNA-Val (CAC) (tRNA-Val-CAC-1-1)
  14. Thermus oshimai tRNA-Val
  15. Thermus scotoductus (hydrocarbon metagenome) tRNA-Val
  16. Thermus scotoductus SA-01 tRNA-Val (CAC) (tRNA-Val-CAC-1-1)
  17. Thermus sp. 93170 tRNA-Val
  18. Thermus sp. CCB_US3_UF1 tRNA-Val (CAC) (tRNA-Val-CAC-1-1)
  19. Thermus thermamylovorans tRNA-Val
  20. Thermus sp. FJN-A tRNA-Val
  21. Thermus sp. H19.2 tRNA-Val
  22. Thermus sp. KWY1 tRNA-Val
  23. Thermus javaensis Thermus sp. LT1-2-5 tRNA-Val
  24. Thermus sp. tRNA-Val
  25. Thermus sp. NEB1569 tRNA-Val
  26. Thermus sp. NMX2.A1 tRNA-Val
  27. Thermus brevis tRNA-Val
  28. Thermus brevis tRNA-Val
  29. Thermus tengchongensis tRNA-Val
  30. Thermus thermophilus HB27 tRNA-Val (CAC) (tRNA-Val-CAC-1-1)
  31. Thermus thermophilus HB8 tRNA-Val (CAC) (tRNA-Val-CAC-1-1)
  32. Thermus thermophilus TRNA(VAL) from Thermus thermophilus (PDB 1GAX, chain C)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...