Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-665-3p URS0000496F65_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-665: Mmu-mir-665 is a microRNA located on chromosome 12, specifically in a cluster with mmu-mir-431, mmu-mir-679, and mmu-mir-667 [PMC6366741]. It has been shown to regulate the expression of the Abcc3 gene in response to colonization [PMC6599659]. Comparative profiling of miRNA expression in conventional and germ-free mice revealed that mmu-mir-665 is dysregulated during colonization and directly targets the 3'-UTR of Abcc3 mRNA, leading to down-regulation of Abcc3 expression [PMC3224226] [PMC3084815]. Luciferase assays and GFP production assays confirmed the repressive effect of mmu-mir-665 on Abcc3 expression [PMC3084815]. In the colon, Abcc3 was identified as a potential target gene for mmu-mir-665, while no overlapping gene was found for the ileum [PMC3084815]. It is suggested that gut microbiota may upregulate Abcc3 expression by down-regulating mmu-mir-665 [PMC3084815]. In vitro experiments demonstrated that upregulation of Abcc3 during colonization was associated with downregulation of mmu-mir-665 [PMC9468484]. These findings suggest that miRNA-mediated regulation by mmu-mir-665 may play a role in gut microbiota-induced changes in host gene expression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAGGAGGCUGAGGUCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications