Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00004943D6_559292

  • 186 nucleotides
  • 5 databases (ENA, IntAct, RefSeq, Rfam, SGD)
  • Found in 90 species

Automated summary: This snoRNA sequence is 186 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (Rfam, ENA, SGD, RefSeq, IntAct). Described in 40 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR4, RF01244). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR4 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 8

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-15095583 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast
EBI-11689752 URS000021BB46_559292 EBI-10821788 URS000021BB46_559292 snr10_yeast_rna
EBI-11016311 intact:EBI-10894903 EBI-10894903 rrna 27sa2
EBI-15096998 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-10959464 P02994 D6VQB6 EBI-6314 Eukaryotic elongation factor 1A P02994 P9513.7 Q7Z7U8 Q7Z8Q8 Q7Z8Q9 TEF1 TEF2 Translation elongation factor 1A YBR0913 YBR118W YPR080W ef1a_yeast
EBI-10959549 P05755 D6VQI4 EBI-16181 P05755 RP21 RPS13B RPS9B S13 SUP46 Small ribosomal subunit protein uS4-B YBR1317 YBR189W YP28 YS11 rs9b_yeast
EBI-10959563 P0CX56 D6VT75 EBI-7433160 MINT-8285651 P0CX56 P35271 RPS18B Small ribosomal subunit protein uS13-B YML026C rs18b_yeast
EBI-11169571 P28007 D3DL41 EBI-7321 GAR1 P28007 YHR089C gar1_yeast snoRNP protein GAR1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACUAUUACAGUCGAUGAGGAUAGGUUAUAGUUCAUGUGUAACAUCUGUGUUUUAAAAUAACUCUAGUUAUCCGGGGCGUUUUUCACAAAGUUUGUGUAAGAUGCUUUCCUGGGUCGAUGUGGAUUGUGCCGUGGCCUUUUUCACCACCUUUAUAGCGGUGCUUUAACUAUUAAUAACUGAGGCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 89 other species

    1. Saccharomyces cerevisiae AWRI796 Small nucleolar RNA snR4
    2. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR4
    3. Saccharomyces cerevisiae EC1118 SNR4
    4. Saccharomyces cerevisiae FostersB Small nucleolar RNA snR4
    5. Saccharomyces cerevisiae FostersO Small nucleolar RNA snR4
    6. Saccharomyces cerevisiae Kyokai no. 7 K7_snR4
    7. Saccharomyces cerevisiae Lalvin QA23 Small nucleolar RNA snR4
    8. Saccharomyces cerevisiae P283 SNR4
    9. Saccharomyces cerevisiae P301 SNR4
    10. Saccharomyces cerevisiae PE-2 SNR4
    11. Saccharomyces cerevisiae Vin13 Small nucleolar RNA snR4
    12. Saccharomyces cerevisiae VL3 Small nucleolar RNA snR4
    13. Saccharomyces cerevisiae YJM1078 SNR4
    14. Saccharomyces cerevisiae YJM1083 SNR4
    15. Saccharomyces cerevisiae YJM1133 SNR4
    16. Saccharomyces cerevisiae YJM1190 SNR4
    17. Saccharomyces cerevisiae YJM1199 SNR4
    18. Saccharomyces cerevisiae YJM1202 SNR4
    19. Saccharomyces cerevisiae YJM1208 SNR4
    20. Saccharomyces cerevisiae YJM1242 SNR4
    21. Saccharomyces cerevisiae YJM1244 SNR4
    22. Saccharomyces cerevisiae YJM1248 SNR4
    23. Saccharomyces cerevisiae YJM1250 SNR4
    24. Saccharomyces cerevisiae YJM1252 SNR4
    25. Saccharomyces cerevisiae YJM1273 SNR4
    26. Saccharomyces cerevisiae YJM1304 SNR4
    27. Saccharomyces cerevisiae YJM1307 SNR4
    28. Saccharomyces cerevisiae YJM1311 SNR4
    29. Saccharomyces cerevisiae YJM1326 SNR4
    30. Saccharomyces cerevisiae YJM1332 SNR4
    31. Saccharomyces cerevisiae YJM1336 SNR4
    32. Saccharomyces cerevisiae YJM1338 SNR4
    33. Saccharomyces cerevisiae YJM1341 SNR4
    34. Saccharomyces cerevisiae YJM1342 SNR4
    35. Saccharomyces cerevisiae YJM1355 SNR4
    36. Saccharomyces cerevisiae YJM1356 SNR4
    37. Saccharomyces cerevisiae YJM1381 SNR4
    38. Saccharomyces cerevisiae YJM1383 SNR4
    39. Saccharomyces cerevisiae YJM1386 SNR4
    40. Saccharomyces cerevisiae YJM1387 SNR4
    41. Saccharomyces cerevisiae YJM1388 SNR4
    42. Saccharomyces cerevisiae YJM1389 SNR4
    43. Saccharomyces cerevisiae YJM1400 SNR4
    44. Saccharomyces cerevisiae YJM1401 SNR4
    45. Saccharomyces cerevisiae YJM1402 SNR4
    46. Saccharomyces cerevisiae YJM1415 SNR4
    47. Saccharomyces cerevisiae YJM1417 SNR4
    48. Saccharomyces cerevisiae YJM1418 SNR4
    49. Saccharomyces cerevisiae YJM1419 SNR4
    50. Saccharomyces cerevisiae YJM1433 SNR4
    51. Saccharomyces cerevisiae YJM1434 SNR4
    52. Saccharomyces cerevisiae YJM1439 SNR4
    53. Saccharomyces cerevisiae YJM1443 SNR4
    54. Saccharomyces cerevisiae YJM1444 SNR4
    55. Saccharomyces cerevisiae YJM1447 SNR4
    56. Saccharomyces cerevisiae YJM1450 SNR4
    57. Saccharomyces cerevisiae YJM1463 SNR4
    58. Saccharomyces cerevisiae YJM1477 SNR4
    59. Saccharomyces cerevisiae YJM1478 SNR4
    60. Saccharomyces cerevisiae YJM1479 SNR4
    61. Saccharomyces cerevisiae YJM1527 SNR4
    62. Saccharomyces cerevisiae YJM1549 SNR4
    63. Saccharomyces cerevisiae YJM1573 SNR4
    64. Saccharomyces cerevisiae YJM1574 SNR4
    65. Saccharomyces cerevisiae YJM1592 SNR4
    66. Saccharomyces cerevisiae YJM1615 SNR4
    67. Saccharomyces cerevisiae YJM189 SNR4
    68. Saccharomyces cerevisiae YJM193 SNR4
    69. Saccharomyces cerevisiae YJM195 SNR4
    70. Saccharomyces cerevisiae YJM244 SNR4
    71. Saccharomyces cerevisiae YJM248 SNR4
    72. Saccharomyces cerevisiae YJM270 SNR4
    73. Saccharomyces cerevisiae YJM320 SNR4
    74. Saccharomyces cerevisiae YJM326 SNR4
    75. Saccharomyces cerevisiae YJM428 SNR4
    76. Saccharomyces cerevisiae YJM450 SNR4
    77. Saccharomyces cerevisiae YJM451 SNR4
    78. Saccharomyces cerevisiae YJM453 SNR4
    79. Saccharomyces cerevisiae YJM456 SNR4
    80. Saccharomyces cerevisiae YJM470 SNR4
    81. Saccharomyces cerevisiae YJM541 SNR4
    82. Saccharomyces cerevisiae YJM554 SNR4
    83. Saccharomyces cerevisiae YJM555 SNR4
    84. Saccharomyces cerevisiae YJM627 SNR4
    85. Saccharomyces cerevisiae YJM681 SNR4
    86. Saccharomyces cerevisiae YJM682 SNR4
    87. Saccharomyces cerevisiae YJM683 SNR4
    88. Saccharomyces cerevisiae YJM689 SNR4
    89. Saccharomyces cerevisiae YJM693 SNR4
    2D structure New