Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Glutamine tRNA (tRNA-Gln), predicted by tRNAscan-SE analysis secondary structure diagram

Saccharomyces cerevisiae S288C Glutamine tRNA (tRNA-Gln), predicted by tRNAscan-SE analysis URS00004942AC_559292

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (ENA, Rfam, SGD, GtRNAdb). Described in 35 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C Glutamine tRNA (tRNA-Gln), predicted by tRNAscan-SE analysis sequence is a product of tRNA-Gln-TTG-3-1 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGUUUUAUAGUGUAGUGGUUAUCACUUUCGGUUUUGAUCCGGACAACCCCGGUUCGAAUCCGGGUAAGACCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 129 other species

    1. Lachancea sp. CBS 6924 tRNA-Gln (TTG) cove score=65.72
    2. Saccharomyces arboricola H-6 tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
    3. Saccharomyces boulardii (nom. inval.) tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-4-1)
    4. Saccharomyces cerevisiae AWRI796 tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
    5. Saccharomyces cerevisiae Gln-tRNA
    6. Saccharomyces cerevisiae CBS 7960 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    7. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    8. Saccharomyces cerevisiae CLIB215 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    9. Saccharomyces cerevisiae CLIB324 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    10. Saccharomyces cerevisiae EC1118 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    11. Saccharomyces cerevisiae EC9-8 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    12. Saccharomyces cerevisiae FL100 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    13. Saccharomyces cerevisiae FostersB tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
    14. Saccharomyces cerevisiae FostersO tRNA
    15. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    16. Saccharomyces cerevisiae Lalvin QA23 tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
    17. Saccharomyces cerevisiae P283 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    18. Saccharomyces cerevisiae P301 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    19. Saccharomyces cerevisiae PE-2 tRNA-Gln
    20. Saccharomyces cerevisiae R008 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    21. Saccharomyces cerevisiae R103 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    22. Saccharomyces cerevisiae RM11-1a tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    23. Saccharomyces cerevisiae Sigma1278b tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    24. Saccharomyces cerevisiae T73 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
    25. Saccharomyces cerevisiae T7 tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
    26. Saccharomyces cerevisiae UC5 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    27. Saccharomyces cerevisiae UFMG A-905 tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
    28. Saccharomyces cerevisiae Vin13 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    29. Saccharomyces cerevisiae VL3 tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
    30. Saccharomyces cerevisiae W303 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    31. Saccharomyces cerevisiae Y10 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
    32. Saccharomyces cerevisiae YJM1078 tRNA-Gln
    33. Saccharomyces cerevisiae YJM1083 tRNA-Gln
    34. Saccharomyces cerevisiae YJM1129 tRNA-Gln
    35. Saccharomyces cerevisiae YJM1133 tRNA-Gln
    36. Saccharomyces cerevisiae YJM1190 tRNA-Gln
    37. Saccharomyces cerevisiae YJM1199 tRNA-Gln
    38. Saccharomyces cerevisiae YJM1202 tRNA-Gln
    39. Saccharomyces cerevisiae YJM1208 tRNA-Gln
    40. Saccharomyces cerevisiae YJM1242 tRNA-Gln
    41. Saccharomyces cerevisiae YJM1244 tRNA-Gln
    42. Saccharomyces cerevisiae YJM1248 tRNA-Gln
    43. Saccharomyces cerevisiae YJM1250 tRNA-Gln
    44. Saccharomyces cerevisiae YJM1252 tRNA-Gln
    45. Saccharomyces cerevisiae YJM1273 tRNA-Gln
    46. Saccharomyces cerevisiae YJM1304 tRNA-Gln
    47. Saccharomyces cerevisiae YJM1307 tRNA-Gln
    48. Saccharomyces cerevisiae YJM1311 tRNA-Gln
    49. Saccharomyces cerevisiae YJM1326 tRNA-Gln
    50. Saccharomyces cerevisiae YJM1332 tRNA-Gln
    51. Saccharomyces cerevisiae YJM1336 tRNA-Gln
    52. Saccharomyces cerevisiae YJM1338 tRNA-Gln
    53. Saccharomyces cerevisiae YJM1341 tRNA-Gln
    54. Saccharomyces cerevisiae YJM1342 tRNA-Gln
    55. Saccharomyces cerevisiae YJM1355 tRNA-Gln
    56. Saccharomyces cerevisiae YJM1356 tRNA-Gln
    57. Saccharomyces cerevisiae YJM1381 tRNA-Gln
    58. Saccharomyces cerevisiae YJM1383 tRNA-Gln
    59. Saccharomyces cerevisiae YJM1385 tRNA-Gln
    60. Saccharomyces cerevisiae YJM1386 tRNA-Gln
    61. Saccharomyces cerevisiae YJM1387 tRNA-Gln
    62. Saccharomyces cerevisiae YJM1388 tRNA-Gln
    63. Saccharomyces cerevisiae YJM1389 tRNA-Gln
    64. Saccharomyces cerevisiae YJM1399 tRNA-Gln
    65. Saccharomyces cerevisiae YJM1400 tRNA-Gln
    66. Saccharomyces cerevisiae YJM1401 tRNA-Gln
    67. Saccharomyces cerevisiae YJM1402 tRNA-Gln
    68. Saccharomyces cerevisiae YJM1415 tRNA-Gln
    69. Saccharomyces cerevisiae YJM1417 tRNA-Gln
    70. Saccharomyces cerevisiae YJM1418 tRNA-Gln
    71. Saccharomyces cerevisiae YJM1419 tRNA-Gln
    72. Saccharomyces cerevisiae YJM1433 tRNA-Gln
    73. Saccharomyces cerevisiae YJM1434 tRNA-Gln
    74. Saccharomyces cerevisiae YJM1439 tRNA-Gln
    75. Saccharomyces cerevisiae YJM1443 tRNA-Gln
    76. Saccharomyces cerevisiae YJM1444 tRNA-Gln
    77. Saccharomyces cerevisiae YJM1447 tRNA-Gln
    78. Saccharomyces cerevisiae YJM1450 tRNA-Gln
    79. Saccharomyces cerevisiae YJM1460 tRNA-Gln
    80. Saccharomyces cerevisiae YJM1463 tRNA-Gln
    81. Saccharomyces cerevisiae YJM1477 tRNA-Gln
    82. Saccharomyces cerevisiae YJM1478 tRNA-Gln
    83. Saccharomyces cerevisiae YJM1479 tRNA-Gln
    84. Saccharomyces cerevisiae YJM1526 tRNA-Gln
    85. Saccharomyces cerevisiae YJM1527 tRNA-Gln
    86. Saccharomyces cerevisiae YJM1549 tRNA-Gln
    87. Saccharomyces cerevisiae YJM1573 tRNA-Gln
    88. Saccharomyces cerevisiae YJM1592 tRNA-Gln
    89. Saccharomyces cerevisiae YJM1615 tRNA-Gln
    90. Saccharomyces cerevisiae YJM189 tRNA-Gln
    91. Saccharomyces cerevisiae YJM193 tRNA-Gln
    92. Saccharomyces cerevisiae YJM195 tRNA-Gln
    93. Saccharomyces cerevisiae YJM244 tRNA-Gln
    94. Saccharomyces cerevisiae YJM248 tRNA-Gln
    95. Saccharomyces cerevisiae YJM269 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    96. Saccharomyces cerevisiae YJM270 tRNA-Gln
    97. Saccharomyces cerevisiae YJM271 tRNA-Gln
    98. Saccharomyces cerevisiae YJM320 tRNA-Gln
    99. Saccharomyces cerevisiae YJM326 tRNA-Gln
    100. Saccharomyces cerevisiae YJM428 tRNA-Gln
    101. Saccharomyces cerevisiae YJM450 tRNA-Gln
    102. Saccharomyces cerevisiae YJM451 tRNA-Gln
    103. Saccharomyces cerevisiae YJM453 tRNA-Gln
    104. Saccharomyces cerevisiae YJM456 tRNA-Gln
    105. Saccharomyces cerevisiae YJM470 tRNA-Gln
    106. Saccharomyces cerevisiae YJM541 tRNA-Gln
    107. Saccharomyces cerevisiae YJM554 tRNA-Gln
    108. Saccharomyces cerevisiae YJM555 tRNA-Gln
    109. Saccharomyces cerevisiae YJM627 tRNA-Gln
    110. Saccharomyces cerevisiae YJM681 tRNA-Gln
    111. Saccharomyces cerevisiae YJM682 tRNA-Gln
    112. Saccharomyces cerevisiae YJM683 tRNA-Gln
    113. Saccharomyces cerevisiae YJM689 tRNA-Gln
    114. Saccharomyces cerevisiae YJM693 tRNA-Gln
    115. Saccharomyces cerevisiae YJM969 tRNA-Gln
    116. Saccharomyces cerevisiae YJM972 tRNA-Gln
    117. Saccharomyces cerevisiae YJM975 tRNA-Gln
    118. Saccharomyces cerevisiae YJM978 tRNA-Gln
    119. Saccharomyces cerevisiae YJM981 tRNA-Gln
    120. Saccharomyces cerevisiae YJM984 tRNA-Gln
    121. Saccharomyces cerevisiae YJM987 tRNA-Gln
    122. Saccharomyces cerevisiae YJM990 tRNA-Gln
    123. Saccharomyces cerevisiae YJM993 tRNA-Gln
    124. Saccharomyces cerevisiae YJM996 tRNA-Gln
    125. Saccharomyces cerevisiae YJSH1 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
    126. Saccharomyces eubayanus tRNA-Gln
    127. Saccharomyces kudriavzevii IFO 1802 tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
    128. Saccharomyces pastorianus tRNA-Gln
    129. Tetrapisispora blattae CBS 6284 tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
    2D structure New