Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS0000492C43_559292

Automated summary: This snoRNA sequence is 203 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (SGD, RefSeq, Rfam, IntAct, ENA). Described in 35 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR34, RF01254). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR34 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 2

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-15095557 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast
EBI-15096980 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GAAUCAAAAAUUUAUUUUUUACACGGAAACGAUGCCACAGUUGACUGAACCUGUCUUCUAACAGUAGUUAAUUGCCAGUAUUUCAAACAAGAUUUGAAAUACGAGUUUCCCAGAAUAAUUUAUUUGGACAGGAUAGGAAGUCCGAUUUCUGUGUUGUCUCAAACGAGGCGAUAGAAUUGGGAUGUCGAAGAAAGUCUACAUUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 30 other species

    1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR34
    2. Saccharomyces cerevisiae YJM1083 SNR34
    3. Saccharomyces cerevisiae YJM1133 SNR34
    4. Saccharomyces cerevisiae YJM1208 SNR34
    5. Saccharomyces cerevisiae YJM1273 SNR34
    6. Saccharomyces cerevisiae YJM1304 SNR34
    7. Saccharomyces cerevisiae YJM1307 SNR34
    8. Saccharomyces cerevisiae YJM1338 SNR34
    9. Saccharomyces cerevisiae YJM1342 SNR34
    10. Saccharomyces cerevisiae YJM1381 SNR34
    11. Saccharomyces cerevisiae YJM1383 SNR34
    12. Saccharomyces cerevisiae YJM1388 SNR34
    13. Saccharomyces cerevisiae YJM1389 SNR34
    14. Saccharomyces cerevisiae YJM1402 SNR34
    15. Saccharomyces cerevisiae YJM1418 SNR34
    16. Saccharomyces cerevisiae YJM1419 SNR34
    17. Saccharomyces cerevisiae YJM1434 SNR34
    18. Saccharomyces cerevisiae YJM1443 SNR34
    19. Saccharomyces cerevisiae YJM1444 SNR34
    20. Saccharomyces cerevisiae YJM1447 SNR34
    21. Saccharomyces cerevisiae YJM1460 SNR34
    22. Saccharomyces cerevisiae YJM1527 SNR34
    23. Saccharomyces cerevisiae YJM1573 SNR34
    24. Saccharomyces cerevisiae YJM1592 SNR34
    25. Saccharomyces cerevisiae YJM1615 SNR34
    26. Saccharomyces cerevisiae YJM428 SNR34
    27. Saccharomyces cerevisiae YJM450 SNR34
    28. Saccharomyces cerevisiae YJM451 SNR34
    29. Saccharomyces cerevisiae YJM470 SNR34
    30. Saccharomyces cerevisiae YJM689 SNR34
    2D structure New