Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1179 URS000048B5E9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1179: Hsa-mir-1179 is a microRNA that has been implicated in various biological processes and diseases [PMC9119753]. It has been shown to competitively bind with MIR133A1HG to regulate the expression of COL4A3, and with downregulated C10orf71-AS1 to regulate the expression of COL4A4, thereby potentially affecting focal adhesion, ECM-receptor interaction, and the PI3K-Akt signaling pathway [PMC9119753]. Hsa-mir-1179 has also been hypothesized to indirectly upregulate OX40L expression by blocking hsa_circ_0000652 [PMC8716807]. Biotin-labeled hsa-mir-1179 probes have been found to enrich hsa_circ_0000652 and OX40L mRNA [PMC8716807]. Abnormally high expression of hsa-mir-1179, along with hsa-mir-4797-3p and hsa-mir-665, has been observed in diabetic retinopathy patients, suggesting their potential as biomarkers for early clinical diagnosis of the disease [PMC9523404]. Hsa-mir-1179 has also been implicated in hepatocellular carcinoma progression and metastasis [PMC7467934]. It is a part of the ceRNA network associated with hsa_circRNA_012448, along with other hub miRNAs [PMC8973950]. In gastric cancer, hsa-mir-1179 is predicted to be associated with KNL1 [PMC6215350]. Finally, it is negatively correlated with ABCA8, ABCA12, ABCB6, ABCB8, and ABCC10 gene expressions in a study on drug resistance mechanisms [PMC9273952].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCAUUCUUUCAUUGGUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Bos taurus (cattle) bta-miR-1179
  2. Equus caballus (horse) eca-miR-1179
  3. Gorilla gorilla gorilla ggo-miR-1179 (MIR1179)
  4. Gorilla gorilla ggo-miR-1179
  5. Macaca mulatta mml-miR-1179
  6. Pan troglodytes ptr-miR-1179
Publications