Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ovis aries (sheep) oar-miR-133 secondary structure diagram

Ovis aries (sheep) oar-miR-133 URS00004883E0_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-133: Oar-mir-133 is a cardiac-specific microRNA (miRNA) identified as a key regulator in sheep heart, with a one nucleotide (nt) difference from its human, mouse, and rat counterparts [PMC5557765]. It is the most abundant cardiac-specific miRNA in the sheep heart and is considered a hub miRNA for its predicted regulatory role on the gene MAPK14 [PMC5831392]. Unlike its counterparts in other species, oar-mir-133 is the predominant form found in sheep heart tissue, with other forms such as hsa-/mmu-/rno-miR-133a-3p and -5p and hsa-/mmu-/rno-miR-133b present in much lower counts [PMC5557765]. It is also noteworthy that oar-mir-133 is currently the only cardiac-specific miRNA listed for sheep in miRBase 21 [PMC5557765]. Next-generation sequencing (NGS) techniques have detected high counts of oar-mir-133, highlighting its significant expression level [PMC5557765]. Additionally, oar-mir-133 has been found to be differentially expressed in both hypothalamic and uterine libraries of sheep [PMC8131964], suggesting its involvement in multiple physiological processes. It has been proposed to have a trans relationship with oar_circ_0007178 and may regulate genes such as IGF2 among others [PMC9464909], indicating its potential role in diverse biological pathways.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGUCCCCUUCAACCAGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 118 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-133
  2. Alligator mississippiensis (American alligator) Ami-Mir-133-P1-v2_3p (mature (guide))
  3. Anolis carolinensis (green anole) Aca-Mir-133-P1-v2_3p (mature (guide))
  4. Anopheles gambiae (African malaria mosquito) aga-miR-133
  5. Apis mellifera ame-miR-133-3p
  6. Ateles geoffroyi (black-handed spider monkey) age-miR-133a
  7. Blattella germanica Bge-Mir-133_3p (mature (guide))
  8. Bombyx mori (domestic silkworm) bmo-miR-133
  9. Bos taurus (domestic cattle) Bta-Mir-133-P1-v2_3p (mature (guide))
  10. Branchiostoma belcheri bbe-miR-133-5p
  11. Branchiostoma floridae Bfl-Mir-133-v2_3p (mature (guide))
  12. Branchiostoma lanceolatum (amphioxus) Bla-Mir-133-v2_3p (mature (guide))
  13. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-133a
  14. Callorhinchus milii (elephant shark) Cmi-Mir-133-P4-v2_3p (mature (guide))
  15. Canis lupus familiaris cfa-miR-133a
  16. Capitella teleta cte-miR-133
  17. Cavia porcellus (domestic guinea pig) Cpo-Mir-133-P1-v2_3p (mature (guide))
  18. Centruroides sculpturatus Csc-Mir-133-P19b_3p (mature (guide))
  19. Cervus elaphus (red deer) cel-miR-133a
  20. Chiloscyllium plagiosum microRNA cpl-miR-133
  21. Chrysemys picta bellii Cpi-Mir-133-P1-v2_3p (mature (guide))
  22. Cochliomyia hominivorax mature cho-miR-133
  23. Cochliomyia macellaria mature cma-miR-133
  24. Columba livia (rock pigeon) Cli-Mir-133-P1-v2_3p (mature (guide))
  25. Culex quinquefasciatus cqu-miR-133
  26. Cyprinus carpio (common carp) ccr-miR-133a-3p
  27. Danio rerio (zebrafish) Dre-Mir-133-P1-v2_3p (mature (guide))
  28. Daphnia magna Dma-Mir-133_3p (mature (guide))
  29. Daphnia pulex dpu-miR-133
  30. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-133-P1-v2_3p (mature (guide))
  31. Dimorphilus gyrociliatus Dgr-Mir-133_3p (mature (guide))
  32. Dinoponera quadriceps dqu-miR-133-3p
  33. Drosophila ananassae dan-miR-133
  34. Drosophila erecta der-miR-133
  35. Drosophila grimshawi dgr-miR-133
  36. Drosophila melanogaster (fruit fly) dme-miR-133-3p
  37. Drosophila mojavensis dmo-miR-133
  38. Drosophila persimilis dpe-miR-133
  39. Drosophila pseudoobscura dps-miR-133
  40. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294465_df_nrg
  41. Drosophila sechellia dse-miR-133
  42. Drosophila simulans dsi-miR-133
  43. Drosophila virilis dvi-miR-133-3p
  44. Drosophila willistoni dwi-miR-133
  45. Drosophila yakuba dya-miR-133
  46. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P1-v2_3p (mature (guide))
  47. Epimenia babai Eba-Mir-133_3p (mature (guide))
  48. Eptatretus burgeri Ebu-Mir-133-P6b-v2_3p (mature (guide))
  49. Equus caballus (horse) Eca-Mir-133-P3-v2_3p (mature (guide))
  50. Euprymna scolopes Esc-Mir-133_3p (mature (guide))
  51. Gadus morhua gmo-miR-133a-3p
  52. Gallus gallus (chicken) gga-miR-133a-3p
  53. Gekko japonicus Gja-Mir-133-P1-v2_3p (mature (guide))
  54. Glossina pallidipes (tsetse fly) Gpa-Mir-133_3p (mature (guide))
  55. Gorilla gorilla gorilla ggo-miR-133a (MIR133A)
  56. Gorilla gorilla (western gorilla) ggo-miR-133a
  57. Haliotis rufescens (red abalone) Hru-Mir-133_3p (mature (guide))
  58. Haplochromis burtoni abu-miR-133a
  59. Heliconius melpomene Hme-Mir-133_3p (mature (guide))
  60. Homo sapiens Hsa-Mir-133-P1-v2_3p (mature (guide))
  61. Hyalella azteca miR-133
  62. Ictalurus punctatus ipu-miR-133a
  63. Ixodes scapularis isc-miR-133
  64. Laevipilina hyalina Lhy-Mir-133_3p (mature (guide))
  65. Lagothrix lagotricha (brown woolly monkey) lla-miR-133a
  66. Lepisosteus oculatus (spotted gar) Loc-Mir-133-P1-v2_3p (mature (guide))
  67. Limulus polyphemus Lpo-Mir-133-P12_3p (mature (guide))
  68. Lineus longissimus Llo-Mir-133_3p (mature (guide))
  69. Lingula anatina Lan-Mir-133_3p (mature (guide))
  70. Lottia gigantea (owl limpet) lgi-miR-133-3p
  71. Loxodonta africana (African savanna elephant) Laf-Mir-133-P1-v2_3p (mature (guide))
  72. Macaca mulatta (Rhesus monkey) Mml-Mir-133-P1-v2_3p (mature (guide))
  73. Macaca nemestrina mne-miR-133a
  74. Magallana gigas (Pacific oyster) Mgi-Mir-133_3p (mature (guide))
  75. Manduca sexta (tobacco hornworm) mse-miR-133
  76. Maylandia zebra (zebra mbuna) mze-miR-133a
  77. Microcaecilia unicolor Mun-Mir-133-P1-v2_3p (mature (guide))
  78. Microcebus murinus (gray mouse lemur) Mmr-Mir-133-P1-v2_3p (mature (guide))
  79. Monodelphis domestica mdo-miR-133a-3p
  80. Monopterus albus Mal-Mir-133-P1-v2_3p (mature (guide))
  81. Mus musculus (house mouse) Mmu-Mir-133-P1-v2_3p (mature (guide))
  82. Nasonia giraulti ngi-miR-133
  83. Nasonia longicornis nlo-miR-133
  84. Nasonia vitripennis nvi-miR-133
  85. Nautilus pompilius Npo-Mir-133-P20_3p (mature (guide))
  86. Neolamprologus brichardi (lyretail cichlid) nbr-miR-133a
  87. Notamacropus eugenii (tammar wallaby) Neu-Mir-133-P1-v2_3p (mature (guide))
  88. Octopus bimaculoides Obi-Mir-133_3p (mature (guide))
  89. Octopus vulgaris (common octopus) Ovu-Mir-133_3p (mature (guide))
  90. Oreochromis niloticus (Nile tilapia) oni-miR-133a
  91. Ornithorhynchus anatinus (platypus) oan-miR-133a-3p
  92. Oryctolagus cuniculus (rabbit) Ocu-Mir-133-P1-v2_3p (mature (guide))
  93. Owenia fusiformis Ofu-Mir-133_3p (mature (guide))
  94. Pan paniscus ppa-miR-133a
  95. Penaeus japonicus miR-133
  96. Phoronis australis Pau-Mir-133_3p (mature (guide))
  97. Platynereis dumerilii (Dumeril's clam worm) Pdu-Mir-133_3p (mature (guide))
  98. Polistes canadensis pca-miR-133-3p
  99. Priapulus caudatus Pca-Mir-133_3p (mature (guide))
  100. Pteropus alecto pal-miR-133a-3p
  101. Ptychodera flava Pfl-Mir-133-v2_3p (mature (guide))
  102. Python bivittatus (Burmese python) Pbv-Mir-133-P1-v2_3p (mature (guide))
  103. Rattus norvegicus (Norway rat) Rno-Mir-133-P1-v2_3p (mature (guide))
  104. Ruditapes philippinarum (Manila clam) Rph-Mir-133_3p (mature (guide))
  105. Saccoglossus kowalevskii sko-miR-133
  106. Saguinus labiatus (red-chested mustached tamarin) sla-miR-133a
  107. Salmo salar (Atlantic salmon) ssa-miR-133a-3p
  108. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-133-P1-v2_3p (mature (guide))
  109. Scyliorhinus torazame (cloudy catshark) Sto-Mir-133-P1-v2_3p (mature (guide))
  110. Sipunculus nudus (marine worm) Snu-Mir-133_3p (mature (guide))
  111. Taeniopygia guttata Tgu-Mir-133-P1-v2_3p (mature (guide))
  112. Tetranychus urticae tur-miR-133-3p
  113. Tetraodon nigroviridis Tni-Mir-133-P1-v2_3p (mature (guide))
  114. Tribolium castaneum (red flour beetle) tca-miR-133-3p
  115. Triops cancriformis tcf-miR-133
  116. Wirenia argentea War-Mir-133_3p (mature (guide))
  117. Xenopus laevis xla-miR-133a
  118. Xenopus tropicalis (tropical clawed frog) xtr-miR-133a
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications