Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-133 URS00004883E0_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-133: Oar-mir-133 is a cardiac-specific miRNA that has been identified as the only related miRNA for the gene MAPK14 [PMC5831392]. It has been found to be a hub miRNA for MAPK14, along with other predicted regulatory miRNAs for different genes [PMC5831392]. Oar-mir-133 is the most abundant cardiac-specific miRNA in sheep heart, with a slight difference in sequence compared to other species-specific miRNAs [PMC5557765]. It is listed as the only cardiac-specific miRNA in miRBase 21 [PMC5557765]. Oar-mir-133 shows high expression levels in NGS analysis, while array analysis shows high expression levels of other species-specific miRNAs that are slightly longer at the 5' end compared to oar-mir-133 [PMC5557765]. Oar-mir-133 has been found to be differentially expressed in both hypothalamic and uterine libraries, along with other specific miRNAs [PMC8131964]. It is also involved in a trans relationship with oar_circ_0007178, as part of a network of differentially expressed lncRNAs and target genes [PMC9464909]. Oar-mir-133 has been implicated in regulating gene expression of various genes, including insulin-like growth factor 2 (IGF2), intraflagellar transport 122, thyroid hormone receptor interactor 13, fat mass and obesity-associated protein (FTO), and ETS proto-oncogene 1 [PMC6498074].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGUCCCCUUCAACCAGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 101 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-133
  2. Alligator mississippiensis Ami-Mir-133-P1-v2_3p (mature (guide))
  3. Anolis carolinensis Aca-Mir-133-P1-v2_3p (mature (guide))
  4. Anopheles gambiae aga-miR-133
  5. Apis mellifera ame-miR-133-3p
  6. Ateles geoffroyi age-miR-133a
  7. Blattella germanica Bge-Mir-133_3p (mature (guide))
  8. Bombyx mori (domestic silkworm) bmo-miR-133
  9. Bos taurus (cattle) Bta-Mir-133-P1-v2_3p (mature (guide))
  10. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-133-5p
  11. Branchiostoma floridae (Florida lancelet) Bfl-Mir-133-v2_3p (mature (guide))
  12. Branchiostoma lanceolatum (amphioxus) Bla-Mir-133-v2_3p (mature (guide))
  13. Callithrix jacchus cja-miR-133a
  14. Callorhinchus milii Cmi-Mir-133-P4-v2_3p (mature (guide))
  15. Canis lupus familiaris cfa-miR-133a
  16. Capitella teleta cte-miR-133
  17. Cavia porcellus (domestic guinea pig) Cpo-Mir-133-P1-v2_3p (mature (guide))
  18. Centruroides sculpturatus (bark scorpion) Csc-Mir-133-P18_3p (mature (guide))
  19. Cervus elaphus (red deer) cel-miR-133a
  20. Chiloscyllium plagiosum microRNA cpl-miR-133
  21. Chrysemys picta bellii Cpi-Mir-133-P1-v2_3p (mature (guide))
  22. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-133
  23. Cochliomyia macellaria mature cma-miR-133
  24. Columba livia Cli-Mir-133-P1-v2_3p (mature (guide))
  25. Crassostrea gigas Cgi-Mir-133_3p (mature (guide))
  26. Culex quinquefasciatus cqu-miR-133
  27. Cyprinus carpio ccr-miR-133a-3p
  28. Danio rerio (zebrafish) Dre-Mir-133-P1-v2_3p (mature (guide))
  29. Daphnia magna Dma-Mir-133_3p (mature (guide))
  30. Daphnia pulex (common water flea) dpu-miR-133
  31. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-133-P1-v2_3p (mature (guide))
  32. Dinoponera quadriceps dqu-miR-133-3p
  33. Drosophila ananassae dan-miR-133
  34. Drosophila erecta der-miR-133
  35. Drosophila grimshawi dgr-miR-133
  36. Drosophila melanogaster dme-miR-133-3p
  37. Drosophila mojavensis dmo-miR-133
  38. Drosophila persimilis dpe-miR-133
  39. Drosophila pseudoobscura dps-miR-133
  40. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294465_df_nrg
  41. Drosophila sechellia dse-miR-133
  42. Drosophila simulans dsi-miR-133
  43. Drosophila virilis dvi-miR-133-3p
  44. Drosophila willistoni dwi-miR-133
  45. Drosophila yakuba dya-miR-133
  46. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P1-v2_3p (mature (guide))
  47. Eptatretus burgeri (inshore hagfish) Ebu-Mir-133-P6b-v2_3p (mature (guide))
  48. Euprymna scolopes Esc-Mir-133_3p (mature (guide))
  49. Gadus morhua (Atlantic cod) gmo-miR-133a-3p
  50. Gallus gallus gga-miR-133a-3p
  51. Gekko japonicus Gja-Mir-133-P1-v2_3p (mature (guide))
  52. Gorilla gorilla gorilla ggo-miR-133a (MIR133A)
  53. Gorilla gorilla ggo-miR-133a
  54. Haplochromis burtoni abu-miR-133a
  55. Heliconius melpomene Hme-Mir-133_3p (mature (guide))
  56. Homo sapiens (human) Hsa-Mir-133-P1-v2_3p (mature (guide))
  57. Hyalella azteca miR-133
  58. Ictalurus punctatus (channel catfish) ipu-miR-133a
  59. Ixodes scapularis isc-miR-133
  60. Lagothrix lagotricha lla-miR-133a
  61. Lepisosteus oculatus (spotted gar) Loc-Mir-133-P1-v2_3p (mature (guide))
  62. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-133-P12_3p (mature (guide))
  63. Lingula anatina Lan-Mir-133_3p (mature (guide))
  64. Lottia gigantea (owl limpet) lgi-miR-133-3p
  65. Macaca mulatta Mml-Mir-133-P1-v2_3p (mature (guide))
  66. Macaca nemestrina mne-miR-133a
  67. Manduca sexta (tobacco hornworm) mse-miR-133
  68. Maylandia zebra (zebra mbuna) mze-miR-133a
  69. Microcaecilia unicolor Mun-Mir-133-P1-v2_3p (mature (guide))
  70. Monodelphis domestica (gray short-tailed opossum) mdo-miR-133a-3p
  71. Monopterus albus (swamp eel) Mal-Mir-133-P1-v2_3p (mature (guide))
  72. Mus musculus Mmu-Mir-133-P1-v2_3p (mature (guide))
  73. Nasonia giraulti ngi-miR-133
  74. Nasonia longicornis nlo-miR-133
  75. Nasonia vitripennis nvi-miR-133
  76. Nautilus pompilius Npo-Mir-133-P20_3p (mature (guide))
  77. Neolamprologus brichardi (lyretail cichlid) nbr-miR-133a
  78. Octopus bimaculoides Obi-Mir-133_3p (mature (guide))
  79. Octopus vulgaris Ovu-Mir-133_3p (mature (guide))
  80. Oreochromis niloticus (Nile tilapia) oni-miR-133a
  81. Ornithorhynchus anatinus oan-miR-133a-3p
  82. Oryctolagus cuniculus Ocu-Mir-133-P1-v2_3p (mature (guide))
  83. Pan paniscus (pygmy chimpanzee) ppa-miR-133a
  84. Penaeus japonicus miR-133
  85. Polistes canadensis pca-miR-133-3p
  86. Pteropus alecto pal-miR-133a-3p
  87. Ptychodera flava Pfl-Mir-133-v2_3p (mature (guide))
  88. Python bivittatus (Burmese python) Pbv-Mir-133-P1-v2_3p (mature (guide))
  89. Rattus norvegicus (Norway rat) Rno-Mir-133-P1-v2_3p (mature (guide))
  90. Saccoglossus kowalevskii sko-miR-133
  91. Saguinus labiatus sla-miR-133a
  92. Salmo salar (Atlantic salmon) ssa-miR-133a-3p
  93. Sarcophilus harrisii Sha-Mir-133-P1-v2_3p (mature (guide))
  94. Scyliorhinus torazame (cloudy catshark) Sto-Mir-133-P1-v2_3p (mature (guide))
  95. Taeniopygia guttata (zebra finch) Tgu-Mir-133-P1-v2_3p (mature (guide))
  96. Tetranychus urticae tur-miR-133-3p
  97. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-133-P1-v2_3p (mature (guide))
  98. Tribolium castaneum (red flour beetle) tca-miR-133-3p
  99. Triops cancriformis tcf-miR-133
  100. Xenopus laevis (African clawed frog) xla-miR-133a
  101. Xenopus tropicalis xtr-miR-133a
Publications