Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-3470b URS00004846F3_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-3470b: Mmu-mir-3470b is a microRNA that has been found to interact with Piwil4, along with mmu-miR-210-5p, while Piwil1 and Piwil2 interact with a larger number of miRNAs [PMC8509654]. Mmu-mir-3470b is one of the miRNAs that may serve as a biomarker for different time points after ischemic stroke, along with other miRNAs such as mmu-miR-2137, mmu-miR-3085-3p, mmu-miR-5126, and mmu-miR-847-5p [PMC6798056]. Following cerebral ischemia-reperfusion, the expression levels of mmu-mir-3470b and other miRNAs were found to change over time [PMC6798056]. Mmu-mir-3470b has been shown to increase hypersensitivity during tonic inflammatory pain states in mice [PMC4579042]. Lentiviral injections of mmu-mir-3470b have been found to downregulate Comt mRNA levels in mice [PMC4579042]. Mmu-mir 3470a and mmu-mir 3470b are located within the B1 transposon sequence and have extensive targets throughout the genome [PMC4579042]. Mmu-mir 3470a and mmu-mir 3470b have been detected after ALPPS surgery and are associated with specific shifts in lipid levels in the hippocampus [PMC6882302] [PMC8295277].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCACUCUGUAGACCAGGCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications