Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-2845 URS000047C1E0_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-2845: Bmo-mir-2845 is a microRNA that has been studied for its regulatory effects on BmFib-L, a silk protein gene in Bombyx mori. Specific primers were designed to amplify BmFib-L, and its expression levels were detected using qPCR [PMC8675719]. Through gene sequence alignment and RNAhybrid analysis, it was confirmed that bmo-mir-2845 significantly inhibited the expression of BmFib-L at the cellular and individual levels [PMC8675719]. The folding free energy of bmo-mir-2845 was found to be < -20.0 kcal/mol, indicating its potential regulatory effects on BmFib-L [PMC8675719]. The regulatory capabilities of bmo-mir-2845 on BmFib-L were validated in BmN cells, and it was found that bmo-mir-2845 downregulated the expression of BmFib-L in these cells [PMC8675719]. The expression of bmo-mir-2845 increased from the 1st to 5th day in the 5th instar of Bombyx mori, while the expression of BmFib-L increased sharply [PMC8675719]. The binding site prediction and mutational analysis confirmed that bmo-mir-2845 has a regulatory role on the binding site within the 3' UTR region of BmFib-L [PMC8675719]. Furthermore, it was observed that miR-2845's regulatory function on BmFib-L showed consistent trends in both BmN cells and individuals, providing additional evidence for its downregulation effect on BmFib-L expression [PMC8675719]. Further studies are needed to fully understand the function and potential target genes regulated by bmo-mir-2845 [PMC8675719].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGUUGCCAGCUGCUGUGCGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications