Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila persimilis tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7) secondary structure diagram

Drosophila persimilis tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7) URS000047C19A_7234

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGUGAUCGUCUAGUGGUUAGGACCCCACGUUGUGGCCGUGGUAACCCAGGUUCGAAUCCUGGUCACGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Aedes aegypti tRNA AAEL016454
  3. Aedes albopictus (Asian tiger mosquito) tRNA
  4. Aethina tumida (Small hive beetle) transfer RNA histidin (anticodon GUG)
  5. Callosobruchus analis hypothetical protein
  6. Callosobruchus chinensis hypothetical protein
  7. Diabrotica virgifera virgifera (Western corn rootworm) transfer RNA histidin (anticodon GUG)
  8. Diaphorina citri (Asian citrus psyllid) tRNA
  9. Drosophila ananassae tRNA-His (GTG) (tRNA-His-GTG-1 1 to 5)
  10. Drosophila busckii tRNA
  11. Drosophila erecta tRNA-His (GTG) (tRNA-His-GTG-1 1 to 6)
  12. Drosophila ficusphila tRNA
  13. Drosophila grimshawi tRNA-His (GTG) (tRNA-His-GTG-1 1 to 5)
  14. Drosophila guanche tRNA.His
  15. Drosophila gunungcola tRNA-OTHER
  16. Drosophila melanogaster transfer RNA:Histidine-GTG 1-5 (Dmel_CR30223, Dmel_CR30249-30252)
  17. Drosophila mojavensis tRNA-His (GTG) (tRNA-His-GTG-1 1 to 4)
  18. Drosophila pseudoobscura pseudoobscura tRNA-His (GTG) (tRNA-His-GTG-1 1 to 5)
  19. Drosophila sechellia tRNA-His (GTG) (tRNA-His-GTG-1 1 to 6)
  20. Drosophila simulans tRNA-His (GTG) (tRNA-His-GTG-1 1 to 5)
  21. Drosophila virilis tRNA-His (GTG) (tRNA-His-GTG-1 1 to 5)
  22. Drosophila willistoni tRNA-His (GTG) (tRNA-His-GTG-1 1 to 5)
  23. Drosophila yakuba tRNA-His (GTG) (tRNA-His-GTG-1 1 to 5)
  24. Eumeta japonica tRNA-His
  25. Leptinotarsa decemlineata tRNA-His
  26. Octopus bimaculoides (Octopus) tRNA-His
  27. Octopus sinensis (East Asian common octopus) tRNA-His
2D structure Publications