v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
P-tRNAfMet from Mycolicibacterium smegmatis MC2 155 (PDB 5ZET, chain B) secondary structure diagram

P-tRNAfMet from Mycolicibacterium smegmatis MC2 155 (PDB 5ZET, chain B) URS000047BBB1_246196

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUACGGCGGUCCAUAGCGGCAGGGAAACGCCCGGUCCCAUCCCGAACCCGGAAGCUAAGCCUGCCAGCGCCGAUGAUACUACCCUUCCGGGUGGAAAAGUAGGACACCGCCGAACAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Mycolicibacterium smegmatis 5S ribosomal RNA from Mycolicibacterium smegmatis (PDB 9E0P, chain B)
  2. Mycolicibacterium smegmatis MKD8 5S ribosomal RNA
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications