v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded 16S rRNA (MT-RNR2) secondary structure diagram

Homo sapiens (human) mitochondrially encoded 16S rRNA (MT-RNR2) URS000047A7F4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-RNR2: MT-RNR2 is a gene that codes for 16S RNA and is found in the mitochondria. It has been identified to have methylated cytosines in the mouse D-loop and MT-RNR2 itself, with different levels of methylation observed in the brain, liver, and testes [PMC4357308]. The regulation of MT-RNR2 is also influenced by three miRNAs: hsa-miR-mit3, hsa-miR-mit6, and hsa-miR-mit4 [PMC4324738]. A study has shown that PU-91, an FDA-approved drug, promotes mitochondrial stabilization and upregulation of PGC-1α. It also protects AMD ARPE-19 transmitochondrial cybrid cells by preserving mitochondrial health, reducing apoptotic cell loss, and inducing upregulation of the MT-RNR2 gene [PMC6756897]. Furthermore, in an analysis of gene expression in various tissues, 10 out of 15 differentially expressed genes were found to be pseudogenes or isoforms of mitochondrial genes such as MT-ND1 (MTND1P20, MTND1P21 and MTND1P23), MT-ND2 (MTND2P12 and MTND2P28), MT-ND4 (MTND4P9), MT-ND5 (MTND5P11), MT-ND6 (MTND6P3), and also including isoforms of the MTRNR2 gene (MTRNR2L1 and MTRNR2L2) [PMC9028063]. These findings highlight the importance of understanding the regulation and function of MT-RNR2 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Contains ambiguity characters: 1 N  IUPAC notation

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUAAACCUAGCCCCAAACCCACUCCACCUUACUACCAGACAACCUUAGCCAAACCAUUUACCCAAAUAAAGUAUAGGCGAUAGAAAUUGAAACCUGGCGCAAUAGAUAUAGUACCGCAAGGGAAAGAUGAAAAAUUAUAACCAAGCAUAAUAUAGCAAGGACUAACCCCUAUACCUUCUGCAUAAUGAAUUAACUAGAAAUAACUUUGCAAGGAGAGCCAAAGCUAAGACCCCCGAAACCAGACGAGCUACCUAAGAACAGCUAAAAGAGCACACCCGUCUAUGUAGCAAAAUAGUGGGAAGAUUUAUAGGUAGAGGCGACAAACCUACCGAGCCUGGUGAUAGCUGGUUGUCCAAGAUAGAAUCUUAGUUCAACUUUAAAUUUGCCCACAGAACCCUCUAAAUCCCCUUGUAAAUUUAACUGUUAGUCCAAAGAGGAACAGCUCUUUGGACACUAGGAAAAAACCUUGUAGAGAGAGUAAAAAAUUUAACACCCAUAGUAGGCCUAAAAGCAGCCACCAAUUAAGAAAGCGUUCAAGCUCAACACCCACUACCUAAAAAAUCCCAAACAUAUAACUGAACUCCUCACACCCAAUUGGACCAAUCUAUCACCCUAUAGAAGAACUAAUGUUAGUAUAAGUAACAUGAAAACAUUCUCCUCCGCAUAAGCCUGCGUCAGAUUAAAACACUGAACUGACAAUUAACAGCCCAAUAUCUACAAUCAACCAACAAGUCAUUAUUACCCUCACUGUCAACCCAACACAGGCAUGCUCAUAAGGAAAGGUUAAAAAAAGUAAAAGGAACUCGGCAAAUCUUACCCCGCCUGUUUACCAAAAACAUCACCUCUAGCAUCACCAGUAUUAGAGGCACCGCCUGCCCAGUGACACAUGUUUAACGGCCGCGGUACCCUAACCGUGCAAAGGUAGCAUAAUCACUUGUUCCUUAAAUAGGGACCUGUAUGAAUGGCUCCACGAGGGUUCAGCUGUCUCUUACUUUUAACCAGUGAAAUUGACCUGCCCGUGAAGAGGCGGGCAUAACACAGCAAGACGAGAAGACCCUAUGGAGCUUUAAUUUAUUAAUGCAAACAGUACCUAACAAACCCACAGGUCCUAAACUACCAAACCUGCAUUAAAAAUUUCGGUUGGGGCGACCUCGGAGCAGAACCCAACCUCCGAGCAGUACAUGCUAAGACUUCACCAGUCAAAGCGAACUACUAUACUCAAUUGAUCCAAUAACUUGACCAACGGAACAAGUUACCCUAGGGAUAACAGCGCAAUCCUAUUCUAGAGUCCAUAUCAACAAUAGGGUUUACGACCUCGAUGUUGGAUCAGGACAUCCCGAUGGUGCAGCCGCUAUUAAAGGUUCGUUUGUUCAACGAUUAAAGUCCUACGUGAUCUGAGUUCAGACCGGAGUAAUCCAGGUCGGUUUCUAUCUACNUUCAAAUUCCUCCCUGUACGAAAGGACAAGAGAAAUAAGGCCUACUUCACAAAGCGCCUUCCCCCGUAAAUGAUAUCAUCUCAACUUAGUAUUAUACCCACACCCACCCAAGAACAGGGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications