Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 492 (ENSGGOG00000028731.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 492 (ENSGGOG00000028731.2) URS0000476A52_9595

116 nucleotides
1 database (Ensembl)
Found in 3 other species
274 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CAACUACAGCCACUACUACAGGACCAUCGAGGACCUGCGGGACAAGAUUCUUGGUGCCACCAUUGAGAACGCCAGGAUUGUCCUGCAGAUCAACAAUGCUCAACUGGCUGCAGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Gorilla gorilla miscellaneous RNA
Homo sapiens (human) microRNA hsa-mir-492 precursor

2D structure

Publications