v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) transfer RNA:Threonine-TGT 1-1 (Dmel_CR31356) secondary structure diagram

Drosophila melanogaster (fruit fly) transfer RNA:Threonine-TGT 1-1 (Dmel_CR31356) URS000046EA04_7227

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCUCUUUAGCUCAGUGGCAGAGCACUGGUCUUGUAAACCAGGGGCCGUGAGUUCAAUUCUCACAAGAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Drosophila ananassae tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  2. Drosophila biarmipes (Fruit fly) transfer RNA threonine (anticodon UGU)
  3. Drosophila bipectinata (Fruit fly) tRNA-Thr
  4. Drosophila elegans (Fruit fly) tRNA-Thr
  5. Drosophila eugracilis (Fruit fly) tRNA-Thr
  6. Drosophila ficusphila (Fruit fly) tRNA-Thr
  7. Drosophila guanche (Fruit fly) tRNA-Thr
  8. Drosophila gunungcola (Fruit fly) transfer RNA threonine (anticodon UGU)
  9. Drosophila kikkawai (Fruit fly) tRNA-Thr
  10. Drosophila miranda (Fruit fly) tRNA-Thr
  11. Drosophila obscura (Fruit fly) tRNA-Thr
  12. Drosophila persimilis tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1, tRNA-Thr-TGT-4-2)
  13. Drosophila pseudoobscura (Fruit fly) tRNA-Thr
  14. Drosophila pseudoobscura pseudoobscura tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1, tRNA-Thr-TGT-4-2)
  15. Drosophila rhopaloa (Fruit fly) tRNA-Thr
  16. Drosophila santomea (Fruit fly) tRNA-Thr
  17. Drosophila sechellia tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  18. Drosophila simulans tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  19. Drosophila subobscura (Fruit fly) tRNA-Thr
  20. Drosophila subpulchrella (Fruit fly) tRNA-Thr
  21. Drosophila suzukii (Fruit fly) tRNA-Thr
  22. Drosophila takahashii (Fruit fly) tRNA-Thr
  23. Drosophila teissieri (Fruit fly) tRNA-Thr
  24. Drosophila yakuba tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications