Drosophila grimshawi tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1, tRNA-Leu-CAA-1-2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila grimshawi tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1, tRNA-Leu-CAA-1-2) URS0000469DE7_7222

83 nucleotides
3 databases (ENA, Ensembl Metazoa, GtRNAdb)
Found in 3 other species
2 publications
1. sncRNA
2. tRNA
3. leucyl tRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUCAGGAUGGCCGAGCGGUCUAAGGCGCCAGACUCAAGUUCUGGUCCUCUUUGAGGGCGUGGGUUCGAAUCCCACUUCUGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Athalia rosae tRNA-Leu
Dendroctonus ponderosae (Mountain pine beetle) tRNA-Leu
Drosophila melanogaster (fruit fly) transfer RNA:Leucine-CAA 1-1 (Dmel_CR30508)

2D structure

Publications