Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Zerene cesonia (Southern Dogface) tRNA-Lys secondary structure diagram

Zerene cesonia (Southern Dogface) tRNA-Lys URS00004699F5_33412

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCGGAUAGCUCAGUCGGUAGAGCAUUGGACUUUUAAUCCAAGGGUCCAGGGUUCAAGUCCCUGUUCGGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Amyelois transitella (Naval orange worm) tRNA-Lys
  2. Bicyclus anynana tRNA-Lys
  3. Bombyx mandarina tRNA-Lys
  4. Bombyx mori tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 7)
  5. Chelonus insularis tRNA-Lys
  6. Danaus plexippus plexippus tRNA
  7. Drosophila busckii tRNA
  8. Drosophila erecta tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 4)
  9. Drosophila ficusphila tRNA
  10. Drosophila grimshawi tRNA-Lys (TTT) (tRNA-Lys-TTT-2-1)
  11. Drosophila gunungcola tRNA-OTHER
  12. Drosophila melanogaster transfer RNA:Lysine-TTT 2-5 (Dmel_CR31197, Dmel_CR31486, Dmel_CR31487, Dmel_CR31489, Dmel_CR31490)
  13. Drosophila mojavensis tRNA-Lys (TTT) (tRNA-Lys-TTT-2-1)
  14. Drosophila sechellia tRNA-Lys (TTT) (tRNA-Lys-TTT-2-1)
  15. Drosophila simulans tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 4)
  16. Drosophila yakuba tRNA-Lys (TTT) (tRNA-Lys-TTT-3 1 to 4)
  17. Eumeta japonica tRNA-Lys
  18. Galleria mellonella tRNA-Lys
  19. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014637.1
  20. Heliconius melpomene (Postman butterfly) tRNA HMEL002613
  21. Helicoverpa armigera (Cotton bollworm) transfer RNA lysine (anticodon UUU)
  22. Helicoverpa zea (Corn earworm) tRNA-Lys
  23. Leguminivora glycinivorella (Soybean pod borer) tRNA-Lys
  24. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015389.1
  25. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016397.1
  26. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016235.1
  27. Manduca sexta tRNA-Lys
  28. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023369.1
  29. Operophtera brumata tRNA
  30. Papilio machaon tRNA
  31. Papilio xuthus tRNA
  32. Pararge aegeria tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 12)
  33. Pectinophora gossypiella (Pink bollworm) transfer RNA lysine (anticodon UUU)
  34. Plutella xylostella tRNA-Lys
  35. Rhamnusium bicolor tRNA-OTHER
  36. Spodoptera frugiperda tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 13)
2D structure Publications