v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae YJM450 RUF22 URS0000466DCE_1294310

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUCAAUUAAUGAAUAAUUAGUUUGAUUAUUUUCCUCUUUAUUUGACCUUAGGAACAGUUUUUAAGGUAUACUCUGAACUGCAAAUUUUUGUCAUAACUCUUGGUAAUCAAGGCUAGAAGUGUACUAUUUUUGCUUUCUGCACAAGGCUUUUUCUUCGGUACGACACAAAAACAACUAUUGUGUCGCAGUCCAUAGAAGGAGCAAGAAAAAAGAAUGUCUUUAAAGGCGAAUGUGAUUCUAUGCUUUCUAGUACCUACUGUGCCGAAUAAUGUGUAAGUCUCAAAAUUCUUUUCUUCCAAAGCAUAUCCAUAAUAUUUACCUUACGCUGGGUAUUUUUUUUUUGGUCACUCCAGAUCUAGUUUUUUAAAACUUGAUCCCAACGUAACUAAAUAUAAACAAGACAAAGCUCGAAAUAAUAUAAUGUAAUUUAGCGAAUGUAGUGUUUAUAUCACCACAUUUGGAGAAUGUACAAUGAAUAGUUUCUCUGUCUCUAAUGGAAUAAGAAUUUAAUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Saccharomyces cerevisiae (baker's yeast) RUF22
  2. Saccharomyces cerevisiae S288C RNA of Unknown Function
  3. Saccharomyces cerevisiae YJM1199 RUF22
  4. Saccharomyces cerevisiae YJM428 RUF22
  5. Saccharomyces cerevisiae YJM689 RUF22