Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Physcomitrium patens ppt-miR535a URS0000464D75_3218

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACAACGAGAGAGAGCACGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Amborella trichopoda atr-miR535
  2. Asparagus officinalis aof-miR535
  3. Carica papaya (papaya) cpa-miR535
  4. Eugenia uniflora (Brazil-cherry) eun-miR535a-5p
  5. Malus domestica mdm-miR535a
  6. Oryza sativa (Asian cultivated rice) osa-miR535-5p
  7. Oryza sativa Japonica Group microRNA osa-miR535-5p
  8. Picea abies pab-miR535c
  9. Prunus persica (peach) ppe-miR535a
  10. Ricinus communis rco-miR535
  11. Vitis vinifera vvi-miR535b
Publications