Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-15b-3p URS000045A9D7_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-15b: Rno-mir-15b is a microRNA that was detected and validated in a study on stroke treated with mild hypothermia [PMC6057705]. The study used RT-PCR to detect the expression of rno-mir-15b and rno-miR-598-3p [PMC6057705]. The expression of rno-mir-15b was found to be significantly decreased at 24 hours after cerebral ischemia, as shown in Figure 2a [PMC6057705]. The study also identified two putative binding sites for miR-15b and miR-16 in the 3'UTR of Faim, suggesting that Faim could be a novel target for these microRNAs [PMC4508667]. Additionally, rno-mir-15b was predicted to target genes involved in the TNF signaling pathway, such as prostaglandin-endoperoxide synthase 2 and Jun proto-oncogene [PMC6377737]. Furthermore, rno-mir-15b was found to be involved in the regulation of the NOD-like proteins response to heat stress by targeting heat shock protein 90 beta family member 1 [PMC6377737]. Overall, these findings suggest that rno-mir-15b plays a role in stroke treated with mild hypothermia and is involved in the regulation of various signaling pathways.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGAAUCAUUAUUUGCUGCUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Dasypus novemcinctus (nine-banded armadillo) dno-miR-15b-3p
  2. Homo sapiens hsa-miR-15b-3p
  3. Macaca mulatta (Rhesus monkey) mml-miR-15b-3p
  4. Mus musculus mmu-miR-15b-3p
  5. Pteropus alecto pal-miR-15b-3p
Publications