Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-767-5p URS000045147B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-767: hsa-mir-767 is a microRNA that has two types: miR-767-3p and miR-767-5p, with hsa-miR767-3p being considered the representative of miRNA-767 [PMC9990296]. In HRT-18 cells, the abundance of hsa-mir-767 significantly decreased after exposure to sorafenib [PMC5187811]. Survival analysis showed that hsa-mir-767 exhibited good partition ability and was associated with decreased survival probability [PMC6448130]. In triple-negative breast cancer (TNBC), hsa-mir-767 was found to be upregulated [PMC7499949]. Additionally, hsa-mir-767 showed a negative correlation with prognosis and expression in lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC) [PMC8605517]. Among the overexpressed miRNAs, hsa-mir-767 exhibited over 5-fold increased expression in cancer cells [PMC5008307]. Furthermore, CHD5 was positively correlated with hsa-mir-767 in uterine corpus endometrial carcinoma (UCEC) [PMC7199595]. Overall, these findings suggest that hsa-mir-767 may play a role in cancer development and progression.

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCACCAUGGUUGUCUGAGCAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Bos taurus (cattle) bta-miR-767
  2. Callithrix jacchus cja-miR-767
  3. Equus caballus eca-miR-767-5p
  4. Macaca mulatta mml-miR-767-5p
  5. Pongo pygmaeus ppy-miR-767-5p
Publications