Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Fusarium falciforme tRNA-Ile secondary structure diagram

Fusarium falciforme tRNA-Ile URS000044E740_195108

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCGUGUAGCUCAGUGGUUAGAGCUUCGUGCUUAUAGCAACAUUCGGUUUCCGAAGUUUCUGUGCCAAAGACCUUUCAAACAGGCCUUUAAAAGCAACGCGACCGUCGUGGGUUCAAUCCCCACCUCGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Saccharomyces cerevisiae AWRI796 tRNA
  2. Saccharomyces cerevisiae (baker's yeast) tRNA-Ile
  3. Saccharomyces cerevisiae EC1118 tRNA-Ile
  4. Saccharomyces cerevisiae FostersO tRNA
  5. Saccharomyces cerevisiae Lalvin QA23 tRNA
  6. Saccharomyces cerevisiae R008 tRNA-Ile
  7. Saccharomyces cerevisiae RM11-1a tRNA-Ile
  8. Saccharomyces cerevisiae S288C tRNA-Ile
  9. Saccharomyces cerevisiae Vin13 tRNA
  10. Saccharomyces pastorianus tRNA-Ile
2D structure