Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae PW5 tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1) secondary structure diagram

Saccharomyces cerevisiae PW5 tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1) URS000044A924_947039

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUUUAUAGUGUAGUGGUUAUCACUUUCGGUUUUGAUCCGAACAACCCCGGUUCGAAUCCGGGUAAGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 136 other species

  1. Fusarium falciforme tRNA-Gln
  2. Hanseniaspora guilliermondii transfer RNA-Gln(TTG)
  3. Hanseniaspora opuntiae tRNA
  4. Hanseniaspora uvarum DSM 2768 tRNA
  5. Hyphopichia burtonii NRRL Y-1933 tRNA
  6. Lachancea dasiensis CBS 10888 tRNA
  7. Lachancea dasiensis tRNA-Gln (TTG) cove score=68.78
  8. Lachancea fermentati tRNA
  9. Lachancea lanzarotensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  10. Lachancea meyersii CBS 8951 tRNA-Gln (TTG) cove score=68.78
  11. Lachancea sp. 'fantastica' tRNA-Gln (TTG) cove score=68.78
  12. Saccharomyces boulardii (nom. inval.) tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  13. Saccharomyces cerevisiae tRNA-Gln
  14. Saccharomyces cerevisiae CBS 7960 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  15. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  16. Saccharomyces cerevisiae CLIB215 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  17. Saccharomyces cerevisiae CLIB324 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  18. Saccharomyces cerevisiae EC1118 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  19. Saccharomyces cerevisiae EC9-8 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  20. Saccharomyces cerevisiae FL100 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  21. Saccharomyces cerevisiae FostersB tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  22. Saccharomyces cerevisiae FostersO tRNA
  23. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  24. Saccharomyces cerevisiae P283 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  25. Saccharomyces cerevisiae P301 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  26. Saccharomyces cerevisiae PE-2 tRNA-Gln
  27. Saccharomyces cerevisiae R008 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  28. Saccharomyces cerevisiae R103 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  29. Saccharomyces cerevisiae RM11-1a tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  30. Saccharomyces cerevisiae S288C tRNA-Gln
  31. Saccharomyces cerevisiae Sigma1278b tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  32. Saccharomyces cerevisiae synthetic construct tRNA-Gln
  33. Saccharomyces cerevisiae T73 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  34. Saccharomyces cerevisiae T7 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  35. Saccharomyces cerevisiae UC5 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  36. Saccharomyces cerevisiae UFMG A-905 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  37. Saccharomyces cerevisiae Vin13 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  38. Saccharomyces cerevisiae VL3 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  39. Saccharomyces cerevisiae W303 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  40. Saccharomyces cerevisiae Y10 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  41. Saccharomyces cerevisiae YJM1078 tRNA-Gln
  42. Saccharomyces cerevisiae YJM1083 tRNA-Gln
  43. Saccharomyces cerevisiae YJM1129 tRNA-Gln
  44. Saccharomyces cerevisiae YJM1133 tRNA-Gln
  45. Saccharomyces cerevisiae YJM1190 tRNA-Gln
  46. Saccharomyces cerevisiae YJM1199 tRNA-Gln
  47. Saccharomyces cerevisiae YJM1202 tRNA-Gln
  48. Saccharomyces cerevisiae YJM1208 tRNA-Gln
  49. Saccharomyces cerevisiae YJM1242 tRNA-Gln
  50. Saccharomyces cerevisiae YJM1244 tRNA-Gln
  51. Saccharomyces cerevisiae YJM1248 tRNA-Gln
  52. Saccharomyces cerevisiae YJM1250 tRNA-Gln
  53. Saccharomyces cerevisiae YJM1252 tRNA-Gln
  54. Saccharomyces cerevisiae YJM1273 tRNA-Gln
  55. Saccharomyces cerevisiae YJM1307 tRNA-Gln
  56. Saccharomyces cerevisiae YJM1311 tRNA-Gln
  57. Saccharomyces cerevisiae YJM1326 tRNA-Gln
  58. Saccharomyces cerevisiae YJM1332 tRNA-Gln
  59. Saccharomyces cerevisiae YJM1336 tRNA-Gln
  60. Saccharomyces cerevisiae YJM1338 tRNA-Gln
  61. Saccharomyces cerevisiae YJM1341 tRNA-Gln
  62. Saccharomyces cerevisiae YJM1342 tRNA-Gln
  63. Saccharomyces cerevisiae YJM1355 tRNA-Gln
  64. Saccharomyces cerevisiae YJM1356 tRNA-Gln
  65. Saccharomyces cerevisiae YJM1381 tRNA-Gln
  66. Saccharomyces cerevisiae YJM1383 tRNA-Gln
  67. Saccharomyces cerevisiae YJM1385 tRNA-Gln
  68. Saccharomyces cerevisiae YJM1386 tRNA-Gln
  69. Saccharomyces cerevisiae YJM1387 tRNA-Gln
  70. Saccharomyces cerevisiae YJM1388 tRNA-Gln
  71. Saccharomyces cerevisiae YJM1389 tRNA-Gln
  72. Saccharomyces cerevisiae YJM1399 tRNA-Gln
  73. Saccharomyces cerevisiae YJM1400 tRNA-Gln
  74. Saccharomyces cerevisiae YJM1401 tRNA-Gln
  75. Saccharomyces cerevisiae YJM1402 tRNA-Gln
  76. Saccharomyces cerevisiae YJM1415 tRNA-Gln
  77. Saccharomyces cerevisiae YJM1417 tRNA-Gln
  78. Saccharomyces cerevisiae YJM1418 tRNA-Gln
  79. Saccharomyces cerevisiae YJM1419 tRNA-Gln
  80. Saccharomyces cerevisiae YJM1433 tRNA-Gln
  81. Saccharomyces cerevisiae YJM1434 tRNA-Gln
  82. Saccharomyces cerevisiae YJM1439 tRNA-Gln
  83. Saccharomyces cerevisiae YJM1443 tRNA-Gln
  84. Saccharomyces cerevisiae YJM1444 tRNA-Gln
  85. Saccharomyces cerevisiae YJM1447 tRNA-Gln
  86. Saccharomyces cerevisiae YJM1460 tRNA-Gln
  87. Saccharomyces cerevisiae YJM1463 tRNA-Gln
  88. Saccharomyces cerevisiae YJM1477 tRNA-Gln
  89. Saccharomyces cerevisiae YJM1478 tRNA-Gln
  90. Saccharomyces cerevisiae YJM1479 tRNA-Gln
  91. Saccharomyces cerevisiae YJM1526 tRNA-Gln
  92. Saccharomyces cerevisiae YJM1527 tRNA-Gln
  93. Saccharomyces cerevisiae YJM1549 tRNA-Gln
  94. Saccharomyces cerevisiae YJM1573 tRNA-Gln
  95. Saccharomyces cerevisiae YJM1574 tRNA-Gln
  96. Saccharomyces cerevisiae YJM1592 tRNA-Gln
  97. Saccharomyces cerevisiae YJM1615 tRNA-Gln
  98. Saccharomyces cerevisiae YJM189 tRNA-Gln
  99. Saccharomyces cerevisiae YJM193 tRNA-Gln
  100. Saccharomyces cerevisiae YJM195 tRNA-Gln
  101. Saccharomyces cerevisiae YJM244 tRNA-Gln
  102. Saccharomyces cerevisiae YJM248 tRNA-Gln
  103. Saccharomyces cerevisiae YJM269 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  104. Saccharomyces cerevisiae YJM270 tRNA-Gln
  105. Saccharomyces cerevisiae YJM271 tRNA-Gln
  106. Saccharomyces cerevisiae YJM320 tRNA-Gln
  107. Saccharomyces cerevisiae YJM326 tRNA-Gln
  108. Saccharomyces cerevisiae YJM428 tRNA-Gln
  109. Saccharomyces cerevisiae YJM450 tRNA-Gln
  110. Saccharomyces cerevisiae YJM451 tRNA-Gln
  111. Saccharomyces cerevisiae YJM453 tRNA-Gln
  112. Saccharomyces cerevisiae YJM456 tRNA-Gln
  113. Saccharomyces cerevisiae YJM470 tRNA-Gln
  114. Saccharomyces cerevisiae YJM541 tRNA-Gln
  115. Saccharomyces cerevisiae YJM554 tRNA-Gln
  116. Saccharomyces cerevisiae YJM555 tRNA-Gln
  117. Saccharomyces cerevisiae YJM627 tRNA-Gln
  118. Saccharomyces cerevisiae YJM681 tRNA-Gln
  119. Saccharomyces cerevisiae YJM682 tRNA-Gln
  120. Saccharomyces cerevisiae YJM683 tRNA-Gln
  121. Saccharomyces cerevisiae YJM689 tRNA-Gln
  122. Saccharomyces cerevisiae YJM693 tRNA-Gln
  123. Saccharomyces cerevisiae YJM969 tRNA-Gln
  124. Saccharomyces cerevisiae YJM972 tRNA-Gln
  125. Saccharomyces cerevisiae YJM975 tRNA-Gln
  126. Saccharomyces cerevisiae YJM978 tRNA-Gln
  127. Saccharomyces cerevisiae YJM981 tRNA-Gln
  128. Saccharomyces cerevisiae YJM984 tRNA-Gln
  129. Saccharomyces cerevisiae YJM987 tRNA-Gln
  130. Saccharomyces cerevisiae YJM990 tRNA-Gln
  131. Saccharomyces cerevisiae YJM993 tRNA-Gln
  132. Saccharomyces cerevisiae YJM996 tRNA-Gln
  133. Saccharomyces cerevisiae YJSH1 tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  134. Saccharomyces pastorianus tRNA-Gln
  135. Saccharomycodes ludwigii tRNA-Gln
  136. Vector YCy2508 tRNA-Gln
2D structure Publications