Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS0000444F9B_559292

Automated summary: This snoRNA sequence is 490 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (RefSeq, SGD, IntAct, ENA). Described in 158 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (Fungi_U3, RF01846). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR17A gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 66

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

IntAct ID Participant Synonyms
EBI-14061559 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast
EBI-10894100 URS00004BEF81_559292 EBI-10821555 URS00004BEF81_559292 rrna 35s yeast
EBI-10894310 URS00004BEF81_559292 EBI-10821555 URS00004BEF81_559292 rrna 35s yeast
EBI-10900270 URS0000182FAB_559292 EBI-10821812 URS0000182FAB_559292 snru14 yeast
EBI-10957782 P11484 Cold-inducible protein YG101 D6VRC7 EBI-29890 EBI-8627 Heat shock protein SSB1 Hsp70 chaperone Ssb P11484 Q05834 SSB1 YDL229W YG101 ssb1_yeast
EBI-10835928 P15646 D2870 D6VRX5 EBI-6838 Histone-glutamine methyltransferase LOT3 NOP1 P15646 P89890 U3 small nucleolar RNA-associated protein NOP1 YDL014W fbrl_yeast
EBI-10950713 P15646 D2870 D6VRX5 EBI-6838 Histone-glutamine methyltransferase LOT3 NOP1 P15646 P89890 U3 small nucleolar RNA-associated protein NOP1 YDL014W fbrl_yeast
EBI-10956744 P15646 D2870 D6VRX5 EBI-6838 Histone-glutamine methyltransferase LOT3 NOP1 P15646 P89890 U3 small nucleolar RNA-associated protein NOP1 YDL014W fbrl_yeast
EBI-11179200 P15646 D2870 D6VRX5 EBI-6838 Histone-glutamine methyltransferase LOT3 NOP1 P15646 P89890 U3 small nucleolar RNA-associated protein NOP1 YDL014W fbrl_yeast
EBI-10899787 P15646 D2870 D6VRX5 EBI-6838 Histone-glutamine methyltransferase LOT3 NOP1 P15646 P89890 U3 small nucleolar RNA-associated protein NOP1 YDL014W fbrl_yeast
EBI-11621140 P20448 D6VWF0 DBP4 DEAD box protein 4 EBI-5612 ECM24 HCA4 Helicase CA4 Helicase UF1 J1250 P20448 Q6B1G2 Q92329 YJL033W dbp4_yeast
EBI-10950932 P25635 D6VR63 EBI-14332 P25633 P25635 P25636 PWP2 U three protein 1 U3 small nucleolar RNA-associated protein 1 UTP1 YCR057C YCR55C/YCR57C/YCR58C pwp2_yeast
EBI-10959020 P28007 D3DL41 EBI-7321 GAR1 P28007 YHR089C gar1_yeast snoRNP protein GAR1
EBI-10951219 P34247 D6VXI8 EBI-20162 P34247 U three protein 11 UTP11 YKL099C YKL449 utp11_yeast
EBI-10956812 P38768 D3DKY1 EBI-24499 NOP17 Nucleolar protein 17 P38768 PIH1 YHR034C pih1_yeast
EBI-10951164 P38882 D3DLE4 EBI-24892 P38882 U three protein 9 U3 protein 9 required for transcription UTP9 YHR196W t-UTP9 utp9_yeast
EBI-10956447 P39990 D3DLM2 EBI-12032 P39990 SNU13 Small nuclear ribonucleoprotein-associated protein 1 YEL026W snu13_yeast
EBI-10956596 P39990 D3DLM2 EBI-12032 P39990 SNU13 Small nuclear ribonucleoprotein-associated protein 1 YEL026W snu13_yeast
EBI-10951137 P40055 D3DLY9 EBI-22597 KRE31 P40055 U three protein 7 UTP7 YER082C utp7_yeast
EBI-10959038 P40089 D3DM53 EBI-10236 LSM5 P40089 YER146W lsm5_yeast
EBI-10901522 P40498 D6VVJ6 EBI-25113 P40498 U three protein 25 UTP25 YIL091C utp25_yeast
EBI-10951176 P42945 D6VW75 EBI-1884 J0808 P42945 U three protein 10 U3 protein 10 required for transcription UTP10 YJL109C t-UTP10 utp10_yeast
EBI-10956557 P46973 D6VWM6 EBI-8359 HIT1 J1705 P46973 YJR055W hit1_yeast
EBI-10956773 P46973 D6VWM6 EBI-8359 HIT1 J1705 P46973 YJR055W hit1_yeast
EBI-10950539 P47083 D6VWH6 EBI-11168 J1411 M phase phosphoprotein 10 MPP10 P47083 YJR002W YJR83.5 mpp10_yeast
EBI-11621242 P47083 D6VWH6 EBI-11168 J1411 M phase phosphoprotein 10 MPP10 P47083 YJR002W YJR83.5 mpp10_yeast
EBI-11621133 P48234 D6VUS5 EBI-23354 ENP2 Essential nuclear protein 2 G6623 P48234 YGR145W nol10_yeast
EBI-11621204 P48234 D6VUS5 EBI-23354 ENP2 Essential nuclear protein 2 G6623 P48234 YGR145W nol10_yeast
EBI-13269430 P53254 D6VUM2 EBI-1878 P53254 U three protein 22 UTP22 YGR090W utp22_yeast
EBI-10951191 P53276 D6VUR0 EBI-23301 P53276 U three protein 8 U3 protein 8 required for transcription UTP8 YGR128C t-UTP8 utp8_yeast
EBI-11664874 Q00416 D6VZ65 E9P9Z4 EBI-16945 L9576.1 Q00416 Q06448 SEN1 YLR430W sen1_yeast tRNA-splicing endonuclease positive effector
EBI-10951118 Q02354 D6VT74 D9461.34 EBI-22119 Q02354 Q04115 U three protein 6 UTP6 YDR449C utp6_yeast
EBI-10901529 Q02354 D6VT74 D9461.34 EBI-22119 Q02354 Q04115 U three protein 6 UTP6 YDR449C utp6_yeast
EBI-10951286 Q02931 D6W3P1 EBI-37773 NAN1 Q02931 U three protein 17 U3 protein 17 required for transcription U3 small nucleolar RNA-associated protein 17 UTP17 YPL126W utp17_yeast
EBI-10956818 Q03940 D6VSH3 EBI-30712 Q03940 RVB1 TIH1 TIP49-homology protein 1 TIP49A TIP49a homolog YDR190C ruvb1_yeast
EBI-10951061 Q04177 D6VT31 D9509.17 EBI-35844 Q04177 U three protein 5 U3 protein 5 required for transcription UTP5 YDR398W t-UTP5 utp5_yeast
EBI-10899717 Q04217 D6VZV1 DEAH box RNA helicase DHR1 DHR1 EBI-1820 ECM16 Extracellular mutant protein 16 Q04217 YM9553.04 YMR128W dhr1_yeast
EBI-10951266 Q04305 D6VZR6 EBI-28183 Q04305 U three protein 15 U3 protein 15 required for transcription UTP15 YM9582.18 YMR093W t-UTP15 utp15_yeast
EBI-10951256 Q04500 D6W0J2 EBI-27917 Q04500 U three protein 14 UTP14 YML093W utp14_yeast
EBI-10894418 Q05022 D6W054 EBI-16011 FMI1 Q05022 RRP5 Ribosomal RNA-processing protein 5 U3 small nucleolar RNA-associated protein RRP5 YM9959.11C YMR229C rrp5_yeast
EBI-10950720 Q05022 D6W054 EBI-16011 FMI1 Q05022 RRP5 Ribosomal RNA-processing protein 5 U3 small nucleolar RNA-associated protein RRP5 YM9959.11C YMR229C rrp5_yeast
EBI-10951246 Q05946 D6VYM2 EBI-34702 Q05946 U three protein 13 UTP13 YLR222C utp13_yeast
EBI-10901545 Q06078 D6VZ43 EBI-359 L8084.22 Q06078 U three protein 21 UTP21 YLR409C utp21_yeast
EBI-11664932 Q06106 D6W4B1 EBI-34383 MRD1 Q06106 YPR112C mrd1_yeast
EBI-11664900 Q06106 D6W4B1 EBI-34383 MRD1 Q06106 YPR112C mrd1_yeast
EBI-10900347 Q06106 D6W4B1 EBI-34383 MRD1 Q06106 YPR112C mrd1_yeast
EBI-10835873 Q06506 D6W4D3 EBI-35124 Q06506 RRP9 YPR137W rrp9_yeast
EBI-10835862 Q06506 D6W4D3 EBI-35124 Q06506 RRP9 YPR137W rrp9_yeast
EBI-10895033 Q06506 D6W4D3 EBI-35124 Q06506 RRP9 YPR137W rrp9_yeast
EBI-10835885 Q06506 D6W4D3 EBI-35124 Q06506 RRP9 YPR137W rrp9_yeast
EBI-11621153 Q06631 BFR2 Brefeldin A resistance protein 2 D6VSS8 EBI-36432 Q06631 Q66RD8 YDR299W bfr2_yeast
EBI-11621196 Q06631 BFR2 Brefeldin A resistance protein 2 D6VSS8 EBI-36432 Q06631 Q66RD8 YDR299W bfr2_yeast
EBI-11621124 Q06631 BFR2 Brefeldin A resistance protein 2 D6VSS8 EBI-36432 Q06631 Q66RD8 YDR299W bfr2_yeast
EBI-10951039 Q06679 D6VSV7 EBI-35712 Q06679 U three protein 4 U3 protein 4 required for transcription UTP4 YDR324C t-UTP4 utp4_yeast
EBI-10951276 Q08492 BUD21 D6W2E1 EBI-37880 O00033 Q08492 U three protein 16 U3 small nucleolar RNA-associated protein 16 UTP16 YOR078W YOR29-29 bud21_yeast
EBI-10951317 Q08492 BUD21 D6W2E1 EBI-37880 O00033 Q08492 U three protein 16 U3 small nucleolar RNA-associated protein 16 UTP16 YOR078W YOR29-29 bud21_yeast
EBI-10956756 Q08932 D6W3H5 EBI-16186 Q08932 RSA1 YPL193W rsa1_yeast
EBI-10951000 Q12136 D1545 D6VRJ7 EBI-36084 Q05842 Q12136 SAS10 U three protein 3 U3 small nucleolar RNA-associated protein 3 U3 snoRNA-associated protein 11 UTP3 YDL153C sas10_yeast
EBI-10951229 Q12220 D6VYC4 DIP2 DOM34-interacting protein 2 EBI-5896 L3116 L9233.1 Q05386 Q12220 U three protein 12 UTP12 YLR129W utp12_yeast
EBI-10956750 Q12460 D6VYK0 EBI-17148 L8167.9 NOP56 Q12460 Ribosome biosynthesis protein SIK1 SIK1 Suppressor of I kappa b protein 1 YLR197W nop56_yeast
EBI-10835899 Q12460 D6VYK0 EBI-17148 L8167.9 NOP56 Q12460 Ribosome biosynthesis protein SIK1 SIK1 Suppressor of I kappa b protein 1 YLR197W nop56_yeast
EBI-10956824 Q12464 D6W3D5 EBI-31814 P1060 Q12464 RVB2 TIH2 TIP49-homology protein 2 TIP49B TIP49b homolog YPL235W ruvb2_yeast
EBI-10956738 Q12499 D6W309 EBI-12126 NOP5 NOP58 Nucleolar protein 5 O6108 Q12499 YOR310C nop58_yeast
EBI-10835909 Q12499 D6W309 EBI-12126 NOP5 NOP58 Nucleolar protein 5 O6108 Q12499 YOR310C nop58_yeast
EBI-11663958 Q12499 D6W309 EBI-12126 NOP5 NOP58 Nucleolar protein 5 O6108 Q12499 YOR310C nop58_yeast
EBI-10950958 Q99207 D1566 D6VRK0 EBI-35157 NOP14 Q99207 U three protein 2 U3 small nucleolar RNA-associated protein 2 UTP2 YDL148C nop14_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUCGACGUACUUCAGUAUGUAAUAUACCCCAAACAUUUUACCCACAAAAAACCAGGAUUUGAAAACUAUAGCAUCUAAAAGUCUUAGGUACUAGAGUUUUCAUUUCGGAGCAGGCUUUUUGAAAAAUUUAAUUCAACCAUUGCAGCAGCUUUUGACUAACACAUUCUACAGUAGGAUCAUUUCUAUAGGAAUCGUCACUCUUUGACUCUUCAAAAGAGCCACUGAAUCCAACUUGGUUGAUGAGUCCCAUAACCUUUGUACCCCAGAGUGAGAAACCGAAAUUGAAUCUAAAUUAGCUUGGUCCGCAAUCCUUAGCGGUUCGGCCAUCUAUAAUUUUGAAUAAAAAUUUUGCUUUGCCGUUGCAUUUGUAGUUUUUUCCUUUGGAAGUAAUUACAAUAUUUUAUGGCGCGAUGAUCUUGACCCAUCCUAUGUACUUCUUUUUUGAAGGGAUAGGGCUCUAUGGGUGGGUACAAAUGGCAGUCUGACAAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 0 other species

    1. Saccharomyces cerevisiae SNR17A
    2D structure New