Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30a-5p URS000043D1A9_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (PSICQUIC, RefSeq, ENA, GeneCards, IntAct, miRBase, LncBase, MalaCards, TarBase). Described in 85 papers. Homo sapiens (human) hsa-miR-30a-5p sequence is a product of miR-30, miR-30a-5p, miR-30a, hsa-miR-30a-5p, hsa-miR-30a, MIR30A genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 156DAG, 15E1.2, 182-FIP, 1R20, 2HOR0202, 3-10C.

Interactions 7

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-30a-5p interacts with:

Interaction id Participant Synonyms
EBI-26474349 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-25436239 intact:EBI-25420098 EBI-25420098 ENST00000627532 mrna_zeb2
EBI-25437853 intact:EBI-25420098 EBI-25420098 ENST00000627532 mrna_zeb2
EBI-25420533 intact:EBI-25420098 EBI-25420098 ENST00000627532 mrna_zeb2
URS000043D1A9_9606-1 Q9NR61 Q9NR61
URS000043D1A9_9606-0 Q9NR61 Q9NR61
EBI-25438020 Q9UKV8 AGO2 Argonaute RISC catalytic component 2 EBI-528269 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer Q8TCZ5 Q8WV58 Q96ID1 Q9UKV8 ago2_human

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAAACAUCCUCGACUGGAAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Anolis carolinensis aca-miR-30a-5p
    2. Capra hircus miR-30a-5p
    3. Gallus gallus (chicken) gga-miR-30a-5p
    4. Gorilla gorilla (western gorilla) ggo-miR-30a-5p
    5. Macaca mulatta mml-miR-30a-5p
    6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30a-5p
    7. Mus musculus mmu-miR-30a-5p
    8. Ovis aries (sheep) miscellaneous RNA
    9. Pan paniscus ppa-miR-30a-5p
    10. Pan troglodytes (chimpanzee) ptr-miR-30a-5p
    11. Pongo pygmaeus ppy-miR-30a-5p
    12. Rattus norvegicus rno-miR-30a-5p
    13. Sus scrofa ssc-miR-30a-5p
    14. Xenopus tropicalis xtr-miR-30a-5p