Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bacillus sp. S17B2 tRNA-Ser secondary structure diagram

Bacillus sp. S17B2 tRNA-Ser URS000043457D_2918907

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAGGAAUACCCAAGUCUGGCUGAAGGGAUCGGUCUUGAAAACCGACAGGGGUGUCAAAGCCCGCGGGGGUUCGAAUCCCUCUUCCUCCGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 210 other species

  1. Alkalicoccobacillus gibsonii tRNA-Ser
  2. Bacillaceae bacterium HSR45 tRNA-Ser
  3. Bacillota bacterium tRNA-Ser
  4. Bacillus aerius tRNA-Ser
  5. Bacillus amyloliquefaciens CC178 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  6. Bacillus amyloliquefaciens DSM 7 = ATCC 23350 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  7. Bacillus amyloliquefaciens EBL11 tRNA-Ser
  8. Bacillus amyloliquefaciens EGD-AQ14 tRNA-Ser
  9. Bacillus amyloliquefaciens IT-45 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  10. Bacillus amyloliquefaciens KHG19 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  11. Bacillus amyloliquefaciens LFB112 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  12. Bacillus amyloliquefaciens LL3 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  13. Bacillus amyloliquefaciens TA208 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  14. Bacillus amyloliquefaciens tRNA-Ser
  15. Bacillus amyloliquefaciens UASWS BA1 tRNA-Ser
  16. Bacillus amyloliquefaciens UMAF6614 tRNA-Ser
  17. Bacillus amyloliquefaciens UMAF6639 tRNA-Ser
  18. Bacillus amyloliquefaciens XH7 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  19. Bacillus atrophaeus 1942 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  20. Bacillus atrophaeus subsp. globigii tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  21. Bacillus atrophaeus tRNA-Ser
  22. Bacillus cabrialesii subsp. tritici tRNA-Ser
  23. Bacillus cabrialesii tRNA-Ser
  24. Bacillus capparidis tRNA-Ser
  25. Bacillus carboniphilus tRNA-Ser
  26. Bacillus cereus tRNA-Ser
  27. Bacillus changyiensis tRNA-Ser
  28. Bacillus glycinifermentans tRNA-Ser
  29. Bacillus gobiensis tRNA-Ser
  30. Bacillus halotolerans tRNA-Ser
  31. Bacillus haynesii tRNA-Ser
  32. Bacillus inaquosorum tRNA-Ser
  33. Bacillus licheniformis CG-B52 tRNA-Ser
  34. Bacillus licheniformis DSM 13 = ATCC 14580 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  35. Bacillus licheniformis LMG 17339 tRNA-Ser
  36. Bacillus licheniformis LMG 6934 tRNA-Ser
  37. Bacillus licheniformis LMG 7559 tRNA-Ser
  38. Bacillus licheniformis tRNA-Ser(tga)
  39. Bacillus licheniformis WX-02 tRNA-Ser
  40. Bacillus methanolicus MGA3 tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  41. Bacillus methanolicus PB1 tRNA-Ser
  42. Bacillus methanolicus tRNA-Ser
  43. Bacillus mojavensis tRNA-Ser
  44. Alkalicoccobacillus murimartini tRNA-Ser
  45. Bacillus nakamurai tRNA-Ser
  46. Bacillus paralicheniformis ATCC 9945a tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  47. Bacillus paralicheniformis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  48. Bacillus rugosus tRNA-Ser
  49. Bacillus siamensis tRNA-Ser
  50. Bacillus sonorensis L12 tRNA-Ser
  51. Bacillus sonorensis tRNA-Ser
  52. Bacillus sp. 1021 tRNA-Ser
  53. Bacillus sp. 1s-1 tRNA-Ser
  54. Bacillus sp. 2211 tRNA-Ser
  55. Bacillus sp. 275 tRNA-Ser
  56. Bacillus sp. 31 tRNA-Ser
  57. Bacillus sp. 5001 tRNA-Ser
  58. Bacillus sp. 5B6 tRNA-Ser
  59. Bacillus sp. 7D3 tRNA-Ser
  60. Bacillus sp. 916 tRNA-Ser
  61. Bacillus sp. A053 tRNA-Ser
  62. Bacillus sp. AAVF1 tRNA-Ser
  63. Bacillus sp. AG1 tRNA-Ser
  64. Bacillus sp. AM1(2019) tRNA-Ser
  65. Bacillus sp. ANT_WA51 tRNA-Ser
  66. Bacillus sp. B28 tRNA-Ser
  67. Bacillus sp. BAC tRNA-Ser
  68. Bacillus sp. BH072 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  69. Bacillus sp. B.PNR1 tRNA-Ser
  70. Bacillus sp. B.PNR2 tRNA-Ser
  71. Bacillus sp. BS3(2021) tRNA-Ser
  72. Bacillus sp. BT1B_CT2 tRNA-Ser
  73. Bacillus sp. Bvel1 tRNA-Ser
  74. Bacillus sp. C28GYM-DRY-1 tRNA-Ser
  75. Bacillus sp. CCNWLCWHY013 tRNA-Ser
  76. Bacillus sp. CMAA 1185 tRNA-Ser
  77. Bacillus sp. CN2 tRNA-Ser
  78. Bacillus sp. CPSM8 tRNA-Ser
  79. Bacillus sp. DM2 tRNA-Ser
  80. Bacillus sp. EKM213B tRNA-Ser
  81. Bacillus sp. EKM417B tRNA-Ser
  82. Bacillus sp. EKM420B tRNA-Ser
  83. Bacillus sp. FJAT-14266 tRNA-Ser
  84. Bacillus sp. FJAT-27445 tRNA-Ser
  85. Bacillus sp. FMQ74 tRNA-Ser
  86. Bacillus sp. FW1 tRNA-Ser
  87. Bacillus sp. Gen2 tRNA-Ser
  88. Bacillus sp. GZB tRNA-Ser
  89. Bacillus sp. H15-1 tRNA-Ser
  90. Bacillus sp. HNA3 tRNA-Ser
  91. Bacillus sp. HSf4 tRNA-Ser
  92. Metabacillus arenae tRNA-Ser
  93. Bacillus sp. ICE1 tRNA-Ser
  94. Bacillus sp. IG2 tRNA-Ser
  95. Bacillus sp. IG6 tRNA-Ser
  96. Bacillus sp. (in: firmicutes) (in: Bacteria) tRNA-Ser
  97. Bacillus sp. IS1 tRNA-Ser
  98. Bacillus sp. ISL-26 tRNA-Ser
  99. Bacillus sp. ISL-32 tRNA-Ser
  100. Bacillus spizizenii ATCC 6633 = JCM 2499 tRNA-Ser
  101. Bacillus spizizenii str. W23 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  102. Bacillus spizizenii tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  103. Bacillus spizizenii TU-B-10 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  104. Bacillus sp. J41TS8 tRNA-Ser
  105. Bacillus sp. J5TS4 tRNA-Ser
  106. Bacillus sp. JNUCC-22 tRNA-Ser
  107. Bacillus sp. JS tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  108. Bacillus sp. KICET-1 tRNA-Ser
  109. Bacillus sp. KICET-3 tRNA-Ser
  110. Bacillus sp. L381 tRNA-Ser
  111. Bacillus sp. LB7 tRNA-Ser
  112. Bacillus sp. LJBS06 tRNA-Ser
  113. Bacillus sp. LJBS17 tRNA-Ser
  114. Bacillus sp. LJBV19 tRNA-Ser
  115. Bacillus sp. LK7 tRNA-Ser
  116. Bacillus sp. LM 4-2 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  117. Bacillus sp. LUNF1 tRNA-Ser
  118. Bacillus sp. LYLB4 tRNA-Ser
  119. Bacillus sp. Lzh-5 tRNA-Ser
  120. Bacillus sp. MBGLi79 tRNA-Ser
  121. Bacillus sp. MBGLi97 tRNA-Ser
  122. Bacillus sp. MD-5 tRNA-Ser
  123. Bacillus sp. MT tRNA-Ser
  124. Bacillus sp. N13C7 tRNA-Ser
  125. Bacillus sp. NEAU-16 tRNA-Ser
  126. Bacillus sp. NEAU-242-2 tRNA-Ser
  127. Bacillus sp. NEAU-CP5 tRNA-Ser
  128. Bacillus sp. NSP9.1 tRNA-Ser
  129. Bacillus sp. PAMC26543 tRNA-Ser
  130. Bacillus sp. PAMC28748 tRNA-Ser
  131. Bacillus sp. Pc3 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  132. Bacillus sp. PW192 tRNA-Ser
  133. Bacillus sp. Rc4 tRNA-Ser
  134. Bacillus sp. RHF6 tRNA-Ser
  135. Bacillus sp. RHFS10 tRNA-Ser
  136. Bacillus sp. RHFS18 tRNA-Ser
  137. Bacillus sp. Ru63 tRNA-Ser
  138. Bacillus sp. S10C12M tRNA-Ser
  139. Bacillus sp. SDLI1 tRNA-Ser
  140. Bacillus sp. SL112 tRNA-Ser
  141. Bacillus sp. SN1 tRNA-Ser
  142. Bacillus sp. SN32 tRNA-Ser
  143. Paenibacillus sp. PL91 tRNA-Ser
  144. Bacillus paralicheniformis tRNA-Ser
  145. Bacillus sp. T17B1 tRNA-Ser
  146. Bacillus sp. T9C1 tRNA-Ser
  147. Bacillus sp. TH008 tRNA-Ser
  148. Bacillus sp. TJS119 tRNA-Ser
  149. Bacillus sp. TSA-4 tRNA-Ser
  150. Bacillus sp. V26 tRNA-Ser
  151. Bacillus sp. WR11 tRNA-Ser
  152. Bacillus sp. WR12 tRNA-Ser
  153. Bacillus sp. X2(2017) tRNA-Ser
  154. Bacillus sp. Y1 tRNA-Ser
  155. Bacillus sp. YP1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  156. Bacillus sp. ZHX3 tRNA-Ser
  157. Bacillus sp. ZY-1-1 tRNA-Ser
  158. Bacillus stercoris tRNA-Ser
  159. Bacillus subtilis BEST7003 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  160. Bacillus subtilis BEST7613 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  161. Bacillus subtilis HJ5 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  162. Bacillus subtilis J22 tRNA-Ser
  163. Bacillus subtilis J24 tRNA-Ser
  164. Bacillus subtilis J27 tRNA-Ser
  165. Bacillus subtilis KCTC 1028 = ATCC 6051a tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  166. Bacillus subtilis MB73/2 tRNA-Ser
  167. Bacillus subtilis PY79 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  168. Bacillus subtilis QB928 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  169. Bacillus subtilis QH-1 tRNA-Ser
  170. Bacillus subtilis subsp. globigii tRNA-Ser
  171. Bacillus inaquosorum KCTC 13429 tRNA-Ser
  172. Bacillus subtilis subsp. natto BEST195 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  173. Bacillus subtilis subsp. natto tRNA-Ser
  174. Bacillus spizizenii tRNA-Ser(tga)
  175. Bacillus subtilis subsp. subtilis 6051-HGW tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  176. Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 = DSM 10 = DSM 10 tRNA-Ser
  177. Bacillus subtilis subsp. subtilis str. 168 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  178. Bacillus subtilis subsp. subtilis str. AG1839 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  179. Bacillus subtilis subsp. subtilis str. BAB-1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  180. Bacillus subtilis subsp. subtilis str. BSP1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  181. Bacillus subtilis subsp. subtilis str. JH642 substr. AG174 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  182. Bacillus subtilis subsp. subtilis str. OH 131.1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  183. Bacillus subtilis subsp. subtilis str. RO-NN-1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  184. Bacillus subtilis subsp. subtilis str. SMY tRNA-Ser
  185. Bacillus subtilis subsp. subtilis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  186. Bacillus subtilis TO-A tRNA-Ser
  187. Bacillus subtilis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  188. Bacillus subtilis XF-1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  189. Bacillus swezeyi tRNA-Ser
  190. Bacillus tequilensis tRNA-Ser(tga)
  191. Bacillus vallismortis tRNA-Ser
  192. Bacillus velezensis AS43.3 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  193. Bacillus velezensis CAU B946 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  194. Bacillus velezensis FZB42 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  195. Bacillus velezensis M27 tRNA-Ser
  196. Bacillus velezensis NAU-B3 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  197. Bacillus velezensis NJN-6 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  198. Bacillus velezensis SQR9 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  199. Bacillus velezensis TrigoCor1448 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  200. Bacillus velezensis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  201. Bacillus velezensis UCMB5033 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  202. Bacillus velezensis UCMB5036 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  203. Bacillus velezensis UCMB5113 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  204. Bacillus velezensis YAU B9601-Y2 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  205. Evansella sp. LMS18 tRNA-Ser
  206. Mycobacteroides abscessus subsp. massiliense tRNA-Ser(tga)
  207. Priestia megaterium tRNA-Ser
  208. Bacillus subtilis A29 tRNA-Ser
  209. Pseudomonas sp. ISL-88 tRNA-Ser
  210. Robertmurraya crescens tRNA-Ser
  211. Salipaludibacillus keqinensis tRNA-Ser
  212. Bacillus velezensis A3 tRNA-Ser
  213. Streptococcus pneumoniae tRNA-Ser(tga)
2D structure