Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila yakuba dya-miR-286 URS000042B23A_7245

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACUAGACCGAACACUCGUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bactrocera dorsalis (oriental fruit fly) bdo-miR-286
  2. Drosophila ananassae dan-miR-286
  3. Drosophila erecta der-miR-286
  4. Drosophila grimshawi dgr-miR-286
  5. Drosophila melanogaster (fruit fly) dme-miR-286-3p
  6. Drosophila mojavensis dmo-miR-286
  7. Drosophila persimilis dpe-miR-286
  8. Drosophila pseudoobscura dps-miR-286
  9. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294431_df_nrg
  10. Drosophila sechellia dse-miR-286
  11. Drosophila simulans dsi-miR-286
  12. Drosophila virilis dvi-miR-286-3p
  13. Drosophila willistoni dwi-miR-286