Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-147 URS0000424278_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-147: Bta-mir-147 is a miRNA that has been identified in various studies [PMC5384155] [PMC5821052] [PMC8568169]. The ViTa algorithm has found that bta-mir-147, along with other miRNAs such as bta-miR-205, bta-miR-26b, and bta-let-7 g, could potentially target the genome [PMC5384155]. Bta-mir-147 is encoded within an intronic region and is part of a group of miRNAs that have been associated with immune modulatory functions [PMC5384155]. It has also been found to be differentially expressed in both control and S. aureus infected groups, suggesting its involvement in the immune response to infection [PMC5821052]. In another study, bta-mir-147 was found to be downregulated during S. aureus infection in mammary gland tissue, while being upregulated in milk samples [PMC8568169]. The differential expression of bta-mir-147 in different sources suggests a regulatory shift caused by the miRNA source [PMC8568169]. Additionally, the expression levels of bta-mir-147 were found to be significantly different between subclinical stages and clinical stages of infection with S. aureus [PMC8568169]. Overall, these studies highlight the potential role of bta-mir-147 in immune modulation and its differential expression during infection.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGUGCGGAAAUGCUUCUGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Publications