Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-144 URS000041D05E_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-144: Bta-mir-144 is a microRNA that has been studied in various contexts. It has been found to be negatively correlated with Ruminococcus 1 and uncultured Cyanobacteria [PMC9378797]. Bta-mir-144, along with other miRNAs, has been positively associated with the blue module [PMC9378797]. In the context of large healthy follicles, bta-mir-144 is upregulated and targets signaling pathways involved in follicular cell proliferation and steroid generation [PMC8316591]. During the transition from day 1–28 postpartum, bta-mir-144 is downregulated [PMC9445238]. Bta-mir-144 has been found to be upregulated in S. aureus infected mammary glands but downregulated in E. coli infected mammary glands, suggesting different roles in mastitis caused by different pathogens [PMC5821052]. Bta-mir-144 has also been predicted to target genes involved in immunity [PMC5821052]. It may serve as a biomarker for mastitis caused by S. aureus and E. coli infections [PMC5821052]. Bta-mir-144 is one of the miRNAs that have been validated for expression changes using RT-qPCR in various tissues such as the hypothalamus, pituitary gland, and mammary gland [PMC9821774]. In bovine growth and atresia follicles, bta-mir-144 is upregulated in large healthy follicles compared to small follicles and plays a role in follicular atresia [PMC10080932]. In mature bovine testis, bta-mir-144 is underexpressed compared to the neonatal group along with other miRNAs such as bta-miR-1185 and bta-miR-431 [PMC7312616].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGUAUAGAUGAUGUACUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Canis lupus familiaris cfa-miR-144
  2. Macaca nemestrina (pig-tailed macaque) mne-miR-144
  3. Mus musculus microRNA miR-144
  4. Pan paniscus ppa-miR-144
  5. Pan troglodytes (chimpanzee) ptr-miR-144
  6. Pongo pygmaeus (Bornean orangutan) ppy-miR-144
Publications