Drosophila erecta (Fruit fly) snRNA Dere\snRNA:U2:1

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

$Drosophila erecta (Fruit fly) snRNA Dere\snRNA:U2:1 secondary structure diagram$

Drosophila erecta (Fruit fly) snRNA Dere\snRNA:U2:1 URS000041B7B0_7220

192 nucleotides
2 databases (ENA, Ensembl Metazoa)
Found in 1 other species
1. sncRNA
2. snRNA
3. u2 snRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AUCGCUUCUCGGCCUUAUGGCUAAGAUCAAAGUGUAGUAUCUGUUCUUAUCAGCUUAACAUCUGAUAGUUCCUCCAUUGGAGGACAACAAAUGUUAAACUGAUUUUUGGAAUCAGACGGAGUGCUAGGGGCUUGCUCCACCUCUGUCGCGGGUUGGCCCGGUAUUGCAGUACCGCCGGGAUUUCGGCCCAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Drosophila melanogaster small nuclear RNA U2 at 34AB a (Dmel_CR31850)

2D structure