Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-322-5p URS000040C1ED_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-322: Rno-mir-322 is a microRNA that has been found to be dysregulated in response to mechanical stretching. In a study, it was observed that after 4 hours of mechanical stretch, rno-mir-322, along with let-7f, miR-103, miR-126, miR-494, miR-126*, miR-130b and miR-195 were significantly dysregulated [PMC5856749]. Another study showed that rno-miR-130b was the only microRNA that showed differential expression after 1 hour of mechanical stretching [PMC5856749]. Knockdown of rno-mir-322 was achieved using dTuD constructs [PMC4499844]. Rno-mir-322 has also been found to be dysregulated in other contexts. In a study on pulmonary hypertension in rats, it was observed that rats subjected to MCT or SuHx had significantly decreased expression of rno-mir-322 in the lungs and isolated LECs [PMC3540168]. The same study also found restoration of rno-mir-322 levels in the isolated LECs after overexpression [PMC3540168]. Furthermore, it was demonstrated that overexpressing rno-mir-322 or rno-miR503 mimics downregulated FGF2 and FGFR1 expression in isolated rat LECs [PMC3540168].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCAGCAAUUCAUGUUUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications