Dasypus novemcinctus (nine-banded armadillo) dno-miR-383-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-383-3p URS0000406128_9361

21 nucleotides
1 database (miRBase)
Found in 10 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CCACAGCACUGCCUGGUCAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Gallus gallus (chicken) gga-miR-383-3p
Homo sapiens Hsa-Mir-383-v1_3p* (star (passenger))
Mus musculus (house mouse) mmu-miR-383-3p
Ophiophagus hannah (king cobra) oha-miR-383-3p
Oryctolagus cuniculus ocu-miR-383-3p
Pteropus alecto (black flying fox) pal-miR-383-3p
Python bivittatus pbv-miR-383-3p
Rattus norvegicus (Norway rat) rno-miR-383-3p
Sus scrofa ssc-miR-383
Taeniopygia guttata (zebra finch) tgu-miR-383-3p