Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-106a-5p URS00003FE4D4_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (LncBase, TarBase, MirGeneDB, GeneCards, MalaCards, RefSeq, ENA, miRBase, IntAct). Described in 67 papers. Homo sapiens (human) hsa-miR-106a-5p sequence is a product of hsa-miR-106a, miR-106a-5p, miR-106a, miR-106, hsa-miR-106a-5p, MIR106A genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 182-FIP, 2PP2A, 3-10C, 3G2, 3H11Ag, 3pK, 4833431A01Rik, 721P, 82-FIP, A-LAP.

Interactions 3

According to IntAct, Homo sapiens (human) hsa-miR-106a-5p interacts with:

IntAct ID Participant Synonyms
EBI-21019179 intact:EBI-21019154 EBI-21019154 ENST00000227507 mrna_ccnd1
EBI-22030940 intact:EBI-22030861 EBI-22030861 ENST00000622179.4 mrna_sirpa
EBI-25425524 intact:EBI-25424500 EBI-25424500 ENST00000307407 mrna_il8

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAAAGUGCUUACAGUGCAGGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species