Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-28 URS00003E47B1_9600

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGAGCUCACAGUCUAUUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Ateles geoffroyi age-miR-28
  2. Bos taurus bta-miR-28
  3. Canis lupus familiaris Cfa-Mir-28-P1_5p (mature (co-guide))
  4. Cavia porcellus cpo-miR-28-5p
  5. Dasypus novemcinctus dno-miR-28-5p
  6. Equus caballus (horse) eca-miR-28-5p
  7. Gorilla gorilla gorilla ggo-miR-28 (MIR28)
  8. Gorilla gorilla (western gorilla) ggo-miR-28
  9. Homo sapiens hsa-miR-28-5p
  10. Lagothrix lagotricha (brown woolly monkey) lla-miR-28
  11. Macaca mulatta mml-miR-28-5p
  12. Macaca nemestrina mne-miR-28
  13. Mus musculus (house mouse) mmu-miR-28a-5p
  14. Oryctolagus cuniculus (rabbit) ocu-miR-28-5p
  15. Pan paniscus ppa-miR-28
  16. Pan troglodytes ptr-miR-28
  17. Rattus norvegicus rno-miR-28-5p
  18. Saguinus labiatus sla-miR-28
  19. Sus scrofa (pig) ssc-miR-28-5p
  20. Tupaia chinensis (Chinese tree shrew) tch-miR-28-5p