Cavia porcellus (domestic guinea pig) cpo-miR-148a-5p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (domestic guinea pig) cpo-miR-148a-5p URS00003E16E5_10141

22 nucleotides
1 database (miRBase)
Found in 8 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AAAGUUCUGAGACACUCCGACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Capra hircus chi-miR-148a-5p
Cervus elaphus (red deer) cel-miR-148*
Dasypus novemcinctus (nine-banded armadillo) dno-miR-148a-5p
Homo sapiens (human) hsa-miR-148a-5p
Macaca mulatta mml-miR-148a-5p
Mus musculus (house mouse) mmu-miR-148a-5p
Oryctolagus cuniculus ocu-miR-148a-5p
Sus scrofa ssc-miR-148a-5p