Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM195 tRNA-Gly secondary structure diagram

Saccharomyces cerevisiae YJM195 tRNA-Gly URS00003D815B_1294305

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAGAUAUAAGUUAAUUGGUAAACUGGAUGUCUUCCAAACAUUGAAUGCGAGUUCGAUUCUCGCUAUCUAUAAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 98 other species

  1. Saccharomyces cerevisiae tRNA-Gly
  2. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Gly
  3. Saccharomyces cerevisiae PE-2 tRNA-Gly
  4. Saccharomyces cerevisiae S288C tRNA-Gly
  5. Saccharomyces cerevisiae YJM1078 tRNA-Gly
  6. Saccharomyces cerevisiae YJM1083 tRNA-Gly
  7. Saccharomyces cerevisiae YJM1129 tRNA-Gly
  8. Saccharomyces cerevisiae YJM1133 tRNA-Gly
  9. Saccharomyces cerevisiae YJM1190 tRNA-Gly
  10. Saccharomyces cerevisiae YJM1199 tRNA-Gly
  11. Saccharomyces cerevisiae YJM1202 tRNA-Gly
  12. Saccharomyces cerevisiae YJM1208 tRNA-Gly
  13. Saccharomyces cerevisiae YJM1242 tRNA-Gly
  14. Saccharomyces cerevisiae YJM1244 tRNA-Gly
  15. Saccharomyces cerevisiae YJM1248 tRNA-Gly
  16. Saccharomyces cerevisiae YJM1250 tRNA-Gly
  17. Saccharomyces cerevisiae YJM1252 tRNA-Gly
  18. Saccharomyces cerevisiae YJM1273 tRNA-Gly
  19. Saccharomyces cerevisiae YJM1304 tRNA-Gly
  20. Saccharomyces cerevisiae YJM1307 tRNA-Gly
  21. Saccharomyces cerevisiae YJM1311 tRNA-Gly
  22. Saccharomyces cerevisiae YJM1326 tRNA-Gly
  23. Saccharomyces cerevisiae YJM1332 tRNA-Gly
  24. Saccharomyces cerevisiae YJM1336 tRNA-Gly
  25. Saccharomyces cerevisiae YJM1338 tRNA-Gly
  26. Saccharomyces cerevisiae YJM1341 tRNA-Gly
  27. Saccharomyces cerevisiae YJM1342 tRNA-Gly
  28. Saccharomyces cerevisiae YJM1355 tRNA-Gly
  29. Saccharomyces cerevisiae YJM1356 tRNA-Gly
  30. Saccharomyces cerevisiae YJM1381 tRNA-Gly
  31. Saccharomyces cerevisiae YJM1383 tRNA-Gly
  32. Saccharomyces cerevisiae YJM1385 tRNA-Gly
  33. Saccharomyces cerevisiae YJM1386 tRNA-Gly
  34. Saccharomyces cerevisiae YJM1387 tRNA-Gly
  35. Saccharomyces cerevisiae YJM1388 tRNA-Gly
  36. Saccharomyces cerevisiae YJM1389 tRNA-Gly
  37. Saccharomyces cerevisiae YJM1399 tRNA-Gly
  38. Saccharomyces cerevisiae YJM1400 tRNA-Gly
  39. Saccharomyces cerevisiae YJM1401 tRNA-Gly
  40. Saccharomyces cerevisiae YJM1402 tRNA-Gly
  41. Saccharomyces cerevisiae YJM1415 tRNA-Gly
  42. Saccharomyces cerevisiae YJM1417 tRNA-Gly
  43. Saccharomyces cerevisiae YJM1418 tRNA-Gly
  44. Saccharomyces cerevisiae YJM1419 tRNA-Gly
  45. Saccharomyces cerevisiae YJM1433 tRNA-Gly
  46. Saccharomyces cerevisiae YJM1434 tRNA-Gly
  47. Saccharomyces cerevisiae YJM1439 tRNA-Gly
  48. Saccharomyces cerevisiae YJM1443 tRNA-Gly
  49. Saccharomyces cerevisiae YJM1444 tRNA-Gly
  50. Saccharomyces cerevisiae YJM1447 tRNA-Gly
  51. Saccharomyces cerevisiae YJM1450 tRNA-Gly
  52. Saccharomyces cerevisiae YJM1460 tRNA-Gly
  53. Saccharomyces cerevisiae YJM1463 tRNA-Gly
  54. Saccharomyces cerevisiae YJM1477 tRNA-Gly
  55. Saccharomyces cerevisiae YJM1478 tRNA-Gly
  56. Saccharomyces cerevisiae YJM1479 tRNA-Gly
  57. Saccharomyces cerevisiae YJM1526 tRNA-Gly
  58. Saccharomyces cerevisiae YJM1527 tRNA-Gly
  59. Saccharomyces cerevisiae YJM1549 tRNA-Gly
  60. Saccharomyces cerevisiae YJM1573 tRNA-Gly
  61. Saccharomyces cerevisiae YJM1574 tRNA-Gly
  62. Saccharomyces cerevisiae YJM1592 tRNA-Gly
  63. Saccharomyces cerevisiae YJM1615 tRNA-Gly
  64. Saccharomyces cerevisiae YJM189 tRNA-Gly
  65. Saccharomyces cerevisiae YJM193 tRNA-Gly
  66. Saccharomyces cerevisiae YJM244 tRNA-Gly
  67. Saccharomyces cerevisiae YJM248 tRNA-Gly
  68. Saccharomyces cerevisiae YJM270 tRNA-Gly
  69. Saccharomyces cerevisiae YJM271 tRNA-Gly
  70. Saccharomyces cerevisiae YJM320 tRNA-Gly
  71. Saccharomyces cerevisiae YJM326 tRNA-Gly
  72. Saccharomyces cerevisiae YJM428 tRNA-Gly
  73. Saccharomyces cerevisiae YJM450 tRNA-Gly
  74. Saccharomyces cerevisiae YJM451 tRNA-Gly
  75. Saccharomyces cerevisiae YJM453 tRNA-Gly
  76. Saccharomyces cerevisiae YJM456 tRNA-Gly
  77. Saccharomyces cerevisiae YJM470 tRNA-Gly
  78. Saccharomyces cerevisiae YJM541 tRNA-Gly
  79. Saccharomyces cerevisiae YJM554 tRNA-Gly
  80. Saccharomyces cerevisiae YJM555 tRNA-Gly
  81. Saccharomyces cerevisiae YJM627 tRNA-Gly
  82. Saccharomyces cerevisiae YJM681 tRNA-Gly
  83. Saccharomyces cerevisiae YJM682 tRNA-Gly
  84. Saccharomyces cerevisiae YJM683 tRNA-Gly
  85. Saccharomyces cerevisiae YJM689 tRNA-Gly
  86. Saccharomyces cerevisiae YJM693 tRNA-Gly
  87. Saccharomyces cerevisiae YJM789 tRNA-Gly
  88. Saccharomyces cerevisiae YJM969 tRNA-Gly
  89. Saccharomyces cerevisiae YJM972 tRNA-Gly
  90. Saccharomyces cerevisiae YJM975 tRNA-Gly
  91. Saccharomyces cerevisiae YJM978 tRNA-Gly
  92. Saccharomyces cerevisiae YJM981 tRNA-Gly
  93. Saccharomyces cerevisiae YJM984 tRNA-Gly
  94. Saccharomyces cerevisiae YJM987 tRNA-Gly
  95. Saccharomyces cerevisiae YJM990 tRNA-Gly
  96. Saccharomyces cerevisiae YJM993 tRNA-Gly
  97. Saccharomyces cerevisiae YJM996 tRNA-Gly
  98. Saccharomyces mikatae tRNA-Gly
2D structure