Homo sapiens (human) hsa-miR-422a

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-422a URS00003CC245_9606

22 nucleotides
6 databases (GeneCards, LncBase, MalaCards, miRBase, RefSeq, TarBase)
Found in 1 other species
142 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-422a: Hsa-mir-422a is a mature miRNA that was found to be significantly upregulated after infliximab therapy in endoscopic responders, along with hsa-miR-10b-5p, hsa-miR-375, and hsa-miR-378a-3p [PMC4070603]. Additionally, hsa-mir-422a is suggested to be involved in the metastasis of osteosarcoma (OS), along with hsa-miR-194, mmp3, and VEGFB [PMC8783756].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACUGGACUUAGGGUCAGAAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.