Drosophila yakuba dya-miR-3 URS00003C3A4E_7245

• 22 nucleotides
• 3 databases (Ensembl Metazoa, miRBase, MirGeneDB)
• Found in 12 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UCACUGGGCAAAGUGUGUCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Drosophila ananassae dan-miR-3
2. Drosophila erecta der-miR-3
3. Drosophila grimshawi dgr-miR-3
4. Drosophila melanogaster dme-miR-3-3p
5. Drosophila mojavensis dmo-miR-3
6. Drosophila persimilis dpe-miR-3
7. Drosophila pseudoobscura dps-miR-3
8. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294433_df_nrg
9. Drosophila sechellia dse-miR-3
10. Drosophila simulans dsi-miR-3
11. Drosophila virilis dvi-miR-3-3p
12. Drosophila willistoni dwi-miR-3

Download

• FASTA
• JSON