Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) Dre-Mir-130-P1b1_5p* (star (passenger)) URS00003BD810_7955

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 19 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCUUUCCCUGUUGCACUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Capra hircus (goat) chi-miR-130b-5p
  2. Cavia porcellus (domestic guinea pig) cpo-miR-130b-5p
  3. Cervus elaphus cel-miR-130b-5p
  4. Chrysemys picta cpi-miR-130b-5p
  5. Cricetulus griseus (Chinese hamster) cgr-miR-130b-5p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-130b-5p
  7. Homo sapiens Hsa-Mir-130-P4a_5p (mature (co-guide))
  8. Lepisosteus oculatus (spotted gar) Loc-Mir-130-P4a_5p (mature (co-guide))
  9. Macaca mulatta mml-miR-130b-5p
  10. Mus musculus (house mouse) mmu-miR-130b-5p
  11. Oreochromis niloticus oni-miR-130b-5p
  12. Oryctolagus cuniculus ocu-miR-130b-5p
  13. Papio hamadryas pha-miR-130b
  14. Pundamilia nyererei pny-miR-130b-5p
  15. Rattus norvegicus rno-miR-130b-5p
  16. Salmo salar (Atlantic salmon) ssa-miR-130a-5p
  17. Sus scrofa (pig) ssc-miR-130b-5p
  18. Xenopus laevis (African clawed frog) xla-miR-130b-5p
  19. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3588478