Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Dictyostelium discoideum Dictyostelium signal recognition particle secondary structure diagram

Dictyostelium discoideum Dictyostelium signal recognition particle URS00003BBB9E_44689

  • 278 nucleotides
  • 3 databases (ENA, Rfam, SRPDB)
  • Found in 2 species
  • SRP RNA

Automated summary: This SRP RNA sequence is 278 nucleotides long and is found in Dictyostelium discoideum. Annotated by 3 databases (Rfam, SRPDB, ENA). Described in 4 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (Dictyostelium_SRP, RF01570). Dictyostelium discoideum Dictyostelium signal recognition particle sequence is a product of 7SL srp-RNA, SRP RNA genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUGCAGGAUUGGGUAGCGGCAACCUGUAAUCAAGCGAUGCAUUCGAGGCGAGGACGAGAGCAUUGUUAGGACCUUUGGGACAAGCGACGCAUACAGUUGAUCCACACUAACGUUGGUGUCGACAUACUAUCAGUCUCUAAGGAUUGAAAGUAAGUUGAUAAUGACCAAGUCAAGGUCCAGGCUGGCAACAGAGCAGACAGAGCGAGGCACAUCGAUGGGUAGCGAGGAAAGUCGACUUAAAGUCGUCCAAAGGAAAUAACAAUGUAAACUCGAACAAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 1 other species

    1. Dictyostelium discoideum AX4 signal recognition particle RNA,SRP RNA
    2D structure New