Automated summary: This SRP RNA sequence is 278 nucleotides long and is found in Dictyostelium discoideum AX4. Annotated by 3 databases (Ensembl Protists, DictyBase, ENA). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (Dictyostelium_SRP, RF01570). Dictyostelium discoideum AX4 signal recognition particle RNA,SRP RNA sequence is a product of DDB_G0294413, srpA genes. Found in the Dictyostelium discoideum AX4 reference genome.
This sequence is found in {{ locations.length }} genome
Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
---|---|---|---|---|---|---|---|---|
Loading genome locations... | ||||||||
Failed to load data from server | ||||||||
No genome locations known | ||||||||
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AUGCAGGAUUGGGUAGCGGCAACCUGUAAUCAAGCGAUGCAUUCGAGGCGAGGACGAGAGCAUUGUUAGGACCUUUGGGACAAGCGACGCAUACAGUUGAUCCACACUAACGUUGGUGUCGACAUACUAUCAGUCUCUAAGGAUUGAAAGUAAGUUGAUAAUGACCAAGUCAAGGUCCAGGCUGGCAACAGAGCAGACAGAGCGAGGCACAUCGAUGGGUAGCGAGGAAAGUCGACUUAAAGUCGUCCAAAGGAAAUAACAAUGUAAACUCGAACAAA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.