Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Dictyostelium discoideum AX4 signal recognition particle RNA,SRP RNA secondary structure diagram

Dictyostelium discoideum AX4 signal recognition particle RNA,SRP RNA URS00003BBB9E_352472

  • 278 nucleotides
  • 3 databases (DictyBase, ENA, Ensembl Protists)
  • Found in 1 species
  • SRP RNA

Automated summary: This SRP RNA sequence is 278 nucleotides long and is found in Dictyostelium discoideum AX4. Annotated by 3 databases (ENA, Ensembl Protists, DictyBase). Described in 2 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (Dictyostelium_SRP, RF01570). Dictyostelium discoideum AX4 signal recognition particle RNA,SRP RNA sequence is a product of srpA, DDB_G0294413 genes. Found in the Dictyostelium discoideum AX4 reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUGCAGGAUUGGGUAGCGGCAACCUGUAAUCAAGCGAUGCAUUCGAGGCGAGGACGAGAGCAUUGUUAGGACCUUUGGGACAAGCGACGCAUACAGUUGAUCCACACUAACGUUGGUGUCGACAUACUAUCAGUCUCUAAGGAUUGAAAGUAAGUUGAUAAUGACCAAGUCAAGGUCCAGGCUGGCAACAGAGCAGACAGAGCGAGGCACAUCGAUGGGUAGCGAGGAAAGUCGACUUAAAGUCGUCCAAAGGAAAUAACAAUGUAAACUCGAACAAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 0 other species

    2D structure New