Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 237 (LINC00237) URS00003B7529_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00237: LINC00237 is a novel long non-coding RNA (lncRNA) gene that has been implicated in various diseases and conditions. In MOMO syndrome, a rare genetic disorder, the balanced reciprocal translocation disrupts LINC00237 [PMC6884712]. LINC00237 has been found to have a positive correlation with overall survival in certain conditions [PMC8798494]. It is located at the breakpoint on chromosome 20p11.23 in MOMO syndrome patients [PMC4848934]. The expression of LINC00237 is reduced in patients' lymphoblasts compared to control individuals [PMC4848934]. In tumor progression, LINC00237 is one of the downregulated lncRNAs [PMC5802034]. It has also been associated with better overall survival in patients with low-grade gliomas (LGG) [PMC7390977]. Furthermore, LINC00237 expression is downregulated in gliomas and upregulated in WHO grade III gliomas [PMC7390977]. In various cancer types, including uterine corpus endometrial carcinoma (UCEC) and pancreatic ductal adenocarcinoma (PDAC), high expression of LINC00237 has been associated with longer survival time [PMC9988759] [PMC9601640]. The precise molecular function of LINC00237 remains to be determined, but it may be involved in necroptosis-related processes and self-renewal of tumor initiating cells by promoting stability of β-catenin [PMC9988759] [PMC7470401]. Additionally, it has been implicated in genetic disorders such as BPES and MOMO syndrome but its exact role remains unknown [PMC5502309] Finally, the expression of AL596188.1 and LINC00237 has been positively correlated with overall survival in certain conditions[ PMC9857477].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCGGACUGGGCUGCGCGCGGAGCCCCCUCUUCCCGUGCACAGUGCGGGGCGAGGCUUGGCGAGCGGUGGGUCUGCGCCUUCCCAAGAAGAGACUGGGGCAGCAUGAAUGUGCUGGAAGAUUAGAGGCUGCUGAUGCUGAAGGAAGGAGAAACGAGGAGGAAGUGUCCCUGUGGACAAGUCAUCUCCCUUCAUUUAAGCCAGGGAAGGCUGGGAGGUAUGAAUUUGAAGCUGGACACGUUGCUGCUCCCCUUAAAGUUUGGAUUAUUUUACUAAAGAAGAAGAGAACAGGUACUGUGUAAUUAAUUGGCAGGAGGAGUUUGCUGCCAUAAACACUUGAUGUGUGAAUCCACGCUAGUUCCCUAGCUUCUAAGCCUCAGUUUACUCAUCUGUCACCUGGGAAAAAAUAUUUGCUCGUUCCUCACUAUUAUAUCAGGAAUGAAUUGUGAAGAUAAAAUGAAAUAGUUCACGUAAAGUGCCCAUUAUAGUUCUGGGCACAUAAAUGUUAAGAAAUGGUAAUUUAAGAAUUAAGGCAUGAAAAUAUGUUCAGCUUUACUAGAGACUGGGGGAAUGCAAACUAAAAUGCCAACAAGAUGUAAUUUUUCUUUCCUUUCCAAAUGACAAAAAUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications