v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae CLIB324 tRNA-Val (AAC) (tRNA-Val-AAC-2-1) secondary structure diagram

Saccharomyces cerevisiae CLIB324 tRNA-Val (AAC) (tRNA-Val-AAC-2-1) URS00003B5CA5_929629

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUUUCGUGGUCUAGUCGGUUAUGGCAUCUGCUUAACACGCAGAACGUCCCCAGUUCGAUCCUGGGCGAAAUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Saccharomyces cerevisiae tRNA-Val
  2. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Val (AAC) (tRNA-Val-AAC-3-1)
  3. Saccharomyces cerevisiae S288C tRNA-Val
  4. Saccharomyces cerevisiae W303 tRNA-Val (AAC) (tRNA-Val-AAC-2-1)
  5. Saccharomyces cerevisiae YJM1208 tRNA-Val
  6. Saccharomyces cerevisiae YJM1615 tRNA-Val
  7. Vector YCy2508 tRNA-Val
 2D structure