Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-3473b URS00003B027C_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-3473b: Mmu-mir-3473b is an upregulated miRNA that has been identified in scrapie-infected mouse models [PMC5148024]. It has been shown to be remarkably increased in all three scrapie-infected mouse models, with an average fold-change value of 10.6 [PMC5148024]. The specific primers for mmu-mir-3473b were synthesized by the GeneCopoeia Company, Beijing, China [PMC5148024]. In addition to mmu-mir-3473b, other miRNAs such as mmu-miR-3473a and mmu-miR-3473e were also greatly increased in the brains of the scrapie-infected mouse models [PMC5148024]. Nine miRNAs showed more than a fourfold upregulation, including mmu-miR-341-3p and mmu-miR-879-5p [PMC5148024]. On the other hand, 13 miRNAs revealed more than a fourfold downregulation, including mmu-miR-141-3p and mmu-miR-200a-5p [PMC5148024]. Mmu-mir-3473b was also found to be differently expressed after 7 days of osteogenic differentiation in comparison to basal conditions [PMC4807979]. It is regulated by NONMMUT145297.1 along with other miRNAs such as mmu-miR-3285p and mmu-miR466i5p [PMC7339411]. Mmu-mir3473b was upregulated in the DNCB 14 days group as well as in MSCs incubated with NPs at different concentrations [PMC8698818] [PMC7720507].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCUGGAGAGAUGGCUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications