Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-154 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-154 precursor URS00003AF18B_9597

84 nucleotides
4 databases (ENA, Ensembl, miRBase, RefSeq)
Found in 6 other species
26 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUGGUACUUGAAGAUAGGUUAUCCGUGUUGCCUUCGCUUUAUUUGUGACGAAUCAUACACGGUUGACCUAUUUUUCAGUACCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-154 (ENSGGOG00000028760.2)
Gorilla gorilla microRNA ggo-mir-154 precursor
Homo sapiens microRNA hsa-mir-154 precursor
Pan troglodytes (chimpanzee) microRNA ptr-mir-154 precursor
Pongo abelii miRNA (ENSPPYG00000021777.2)
Pongo pygmaeus microRNA ppy-mir-154 precursor

2D structure

Publications