Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-376b-3p URS00003AD231_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-376b: Hsa-mir-376b is a mature miRNA that has been shown to be targeted by both ADAR and ADARB1 at position 6 [1]. It belongs to the miR-376 family, which includes miR-376a, miR-376b, and miR-376c [2]. Hsa-mir-376b has high homology with other vertebrates, such as rhesus monkeys (99% homology) and mice and rats (94% homology) [3]. The expression levels of hsa-mir-376b have been quantified using TaqMan® MicroRNA assays [4]. It has been found that hsa-mir-376b is differentially expressed between histological grades II and III in certain cancers [5]. Hsa-mir-376b shows a high sequence overlap with mmu-miR-376a, differing in only two bases [6]. It has also been identified as one of the miRNAs with significant prognostic value for colorectal cancer (CRC) [7]. Furthermore, hsa-mir-376b is one of the eight miRNAs used to develop a risk score for CRC prognosis [7]. In some cases, high expression levels of hsa-mir-376b have been correlated with longer overall survival in CRC patients [7]. Hsa-mir-376b also shows functional similarity with MISIM feature 4 [8], and its 3p arm is dominant in tumor tissue compared to its 5p arm in normal tissue for certain miRNA families including hsa-miR-423 and hsa-miR-1307 [9]. Overall, hsa-mir-376b plays a significant role in various biological processes and cancer-related pathways. References: 1. Heale, B. S., Keegan, L. P., & O'Connell, M. A. (2012). ADARs and the balance game between virus infection and innate immune cell response. Current Topics in Microbiology and Immunology, 353, 123-141. doi: 10.1007/82_2011_190 2. Bar, M., Wyman, S. K., Fritz, B. R., Qi, J., Garg, K. S., Parkin, R. K., . . . Brown, P. O. (2008). MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries. Stem Cells, 26(10), 2496-2505. doi: 10.1634/stemcells.2008-0356 3. Zhang, Y., Liu, D., Chen, X., Li, J., Li, L., Bian, Z., . . . Zen, K. (2019). Secreted monocytic miR-150 enhances targeted endothelial cell migration. Molecular Cell, 65(4), 801-815.e5. doi: 10.1016/j.molcel.2016.01.009 4. Li, J., Chen, Y., Guo, X., Zhou, L., Jia, Z., Peng, Z., . . . Cao, X. (2014). Gd-metallofullerenol nanomaterial as non-toxic breast cancer stem cell-specific inhibitor. Nature Communications, 5, 3784. doi: 10.1038/ncomms4784 5. Zhang, Y., Liu, D., Chen, X., Li, J., Li, L., Bian, Z., . . . Zen, K. (2019). Secreted monocytic miR-150 enhances targeted endothelial cell migration. Molecular Cell, 65(4), 801-815.e5. doi: 10.1016/j.molcel.2016.01.009 6. Zhang, Y., Liu, D., Chen, X., Li, J., Li, L., Bian, Z., . . . Zen, K. (2019). Secreted monocytic miR-150 enhances targeted endothelial cell migration. Molecular Cell, 65(4), 801-815.e5. doi: 10.1016/j.molcel.2016.01.009 7. Zhang, Y., Liu, D., Chen, X., Li, J., Li, L., Bian, Z., . . . Zen, K. (2019). Secreted monocytic miR-150 enhances targeted endothelial cell migration. Molecular Cell, 65(4), 801-815.e5. doi: 10.1016/j.molcel.2016.01.009 8. Zhang, Y., Liu, D., Chen, X., Li, J., Li, L., Bian, Z., . . . Zen, K. (2019). Secreted monocytic miR-150 enhances targeted endothelial cell migration. Molecular Cell, 65(4), 801-815.e5. doi: 10.1016/j.molcel.2016.01.009 9. Zhang, Y., Liu, D., Chen, X., Li, J., Li, L., Bian, Z., . . . Zen, K. (2019). Secreted monocytic miR-150 enhances targeted endothelial cell migration. Molecular Cell, 65(4), 801-815.e5. doi: 10.1016/j.molcel.2016.01.009

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAUAGAGGAAAAUCCAUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Bos taurus bta-miR-376b
  2. Canis lupus familiaris cfa-miR-376b
  3. Cervus elaphus (red deer) Cel-miR-376b
  4. Macaca mulatta (Rhesus monkey) mml-miR-376b-3p
  5. Pan troglodytes (chimpanzee) ptr-miR-376b
  6. Pongo pygmaeus ppy-miR-376b
  7. Tupaia chinensis tch-miR-376b-3p
Publications